|
miRBase |
|
Stem-loop sequence hsa-mir-1256 |
|||||
| Accession | MI0006390 | ||||
| Symbol | HGNC:MIR1256 | ||||
| Description | Homo sapiens miR-1256 stem-loop | ||||
| Gene family | MIPF0000594; mir-1256 | ||||
| Stem-loop |
------ gc uuugaagcuuu c g ac u a aguca cuguugaagc gaug ca gcauugacuucuc uagcug g a ||||| |||||||||| |||| || ||||||||||||| |||||| | a ucggu gauaacuuug cuac gu cguaacugaagag aucgau c g acuuug -a ---------uu a a aa c u |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-1256 |
|
| Accession | MIMAT0005907 |
| Sequence |
35 - aggcauugacuucucacuagcu - 56 |
| Deep sequencing | 27 reads, 8 experiments |
| Evidence | experimental; Solexa [1] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|