Stem-loop sequence hsa-mir-1255a

Accession

MI0006389

Symbol

HGNC:MIR1255A

Description

Homo sapiens miR-1255a stem-loop

Gene family

MIPF0000506; mir-1255

Stem-loop

--au    aauccuuu                            ag   a          
    ugga        gaguugcuucucaaggaugagcaaagaa  uag uuuuuuaga 
    ||||        ||||||||||||||||||||||||||||  ||| |||||||| u
    accu        cucaacgaagaguuccuacucguuucuu  auc aagaaaucu 
aauu    ----auuc                            cu   a          

Deep sequencing

343 reads, 18 experiments

Genome context

• Coordinates (GRCh37.p5): chr4: 102251459-102251571 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000363383 ; PPP3CA-004; intron 1

  OTTHUMT00000258379 ; PPP3CA-001; intron 1

  OTTHUMT00000363384 ; PPP3CA-005; intron 1

  OTTHUMT00000258380 ; PPP3CA-002; intron 1

  OTTHUMT00000363386 ; PPP3CA-007; intron 1

  OTTHUMT00000388904 ; PPP3CA-009; intron 1

  OTTHUMT00000388905 ; PPP3CA-010; intron 1

  OTTHUMT00000363383 ; PPP3CA-004; intron 1

  OTTHUMT00000258379 ; PPP3CA-001; intron 1

  OTTHUMT00000363384 ; PPP3CA-005; intron 1

  OTTHUMT00000258380 ; PPP3CA-002; intron 1

  OTTHUMT00000363386 ; PPP3CA-007; intron 1

  OTTHUMT00000388904 ; PPP3CA-009; intron 1

  OTTHUMT00000388905 ; PPP3CA-010; intron 1

  OTTHUMT00000363383 ; PPP3CA-004; intron 1

  OTTHUMT00000258379 ; PPP3CA-001; intron 1

  OTTHUMT00000363384 ; PPP3CA-005; intron 1

  OTTHUMT00000258380 ; PPP3CA-002; intron 1

  OTTHUMT00000363386 ; PPP3CA-007; intron 1

  OTTHUMT00000388904 ; PPP3CA-009; intron 1

  OTTHUMT00000388905 ; PPP3CA-010; intron 1

  ENST00000512215 ; PPP3CA-004; intron 1

  ENST00000394854 ; PPP3CA-001; intron 1

  ENST00000323055 ; PPP3CA-005; intron 1

  ENST00000394853 ; PPP3CA-002; intron 1

  ENST00000507176 ; PPP3CA-007; intron 1

  ENST00000529324 ; PPP3CA-009; intron 1

  ENST00000525819 ; PPP3CA-010; intron 1

  ENST00000523694 ; PPP3CA-201; intron 1

  ENST00000529324 ; PPP3CA-009; intron 1

  ENST00000525819 ; PPP3CA-010; intron 1

  ENST00000523694 ; PPP3CA-201; intron 1

  ENST00000507176 ; PPP3CA-007; intron 1

  ENST00000394854 ; PPP3CA-001; intron 1

  ENST00000323055 ; PPP3CA-005; intron 1

  ENST00000394853 ; PPP3CA-002; intron 1

  ENST00000512215 ; PPP3CA-004; intron 1

  ENST00000512215 ; PPP3CA-004; intron 1

  ENST00000394854 ; PPP3CA-001; intron 1

  ENST00000323055 ; PPP3CA-005; intron 1

  ENST00000394853 ; PPP3CA-002; intron 1

  ENST00000507176 ; PPP3CA-007; intron 1

  ENST00000529324 ; PPP3CA-009; intron 1

  ENST00000525819 ; PPP3CA-010; intron 1

  ENST00000523694 ; PPP3CA-201; intron 1

Database links

• ENTREZGENE: 100302193;MIR1255A
• ENTREZGENE: 100313827;MIR1255A
• HGNC: 35320;MIR1255A

Mature sequence hsa-miR-1255a

• Accession: MIMAT0005906
• Sequence: 28 - aggaugagcaaagaaaguagauu - 50
• Deep sequencing: 338 reads, 16 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1255a
  • MICRORNA.ORG:hsa-miR-1255a
  • MIRDB:hsa-miR-1255a
  • RNA22-HSA:hsa-miR-1255a
  • TARGETMINER:hsa-miR-1255a
  • TARGETSCAN-VERT:hsa-miR-1255a

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).