|
miRBase |
|
Stem-loop sequence hsa-mir-1254-1 |
|||||
| Accession | MI0006388 | ||||
| Previous IDs | hsa-mir-1254 | ||||
| Symbol | HGNC:MIR1254 | ||||
| Description | Homo sapiens miR-1254-1 stem-loop | ||||
| Gene family | MIPF0000614; mir-1254 | ||||
| Stem-loop |
ggu g ---gc -a aa cc -a ua gg aggauu uug gccugg gcuggag ugcagug ac u || |||||| ||| |||||| ||||||| ||||||| || c cu uccuaa aac cggauc cgaccuc augucac ug a -au g aguaa aa -- -- cg uu |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-1254 |
|
| Accession | MIMAT0005905 |
| Sequence |
18 - agccuggaagcuggagccugcagu - 41 |
| Deep sequencing | 395 reads, 14 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|