|
miRBase |
|
Stem-loop sequence hsa-mir-1251 |
|||||
| Accession | MI0006386 | ||||
| Symbol | HGNC:MIR1251 | ||||
| Description | Homo sapiens miR-1251 stem-loop | ||||
| Gene family | MIPF0000621; mir-1251 | ||||
| Stem-loop |
----- gg u a cca --c c gu ac cu gcug aaggcgcuu uc u || || || |||| ||||||||| || u ca ug ga cgac uuucgcgag ag c cggua ga u c ucg aca u |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-1251 |
|
| Accession | MIMAT0005903 |
| Sequence |
5 - acucuagcugccaaaggcgcu - 25 |
| Deep sequencing | 1 reads, 1 experiments |
| Evidence | experimental; Solexa [1], cloned [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|
| 2 |
PMID:18402656
"Hidden layers of human small RNAs"
BMC Genomics. 9:157(2008).
|