Stem-loop sequence hsa-mir-1249

AccessionMI0006384 (change log)
Symbol HGNC:MIR1249
DescriptionHomo sapiens miR-1249 stem-loop
Gene family MIPF0000667; mir-1249
Literature search

16 open access papers mention hsa-mir-1249
(33 sentences)

Stem-loop
   ----g         a  a  u    caa     cuc 
5'      ggaggaggg gg ga gggc   guucc   u
        ||||||||| || || ||||   |||||    
3'      cuucuuccc cc cu cccg   caagg   g
   gucca         -  c  u    ---     ucg 
Get sequence
Deep sequencing
4969 reads, 9.03 reads per million, 155 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 45200954-45201019 [-]
antisense
OTTHUMT00000157076 ; ARHGAP8-005; intron 1
OTTHUMT00000321702 ; ARHGAP8-014; intron 1
OTTHUMT00000321705 ; ARHGAP8-017; intron 2
OTTHUMT00000075088 ; ARHGAP8-001; intron 3
OTTHUMT00000157073 ; ARHGAP8-002; intron 3
OTTHUMT00000321701 ; ARHGAP8-013; intron 3
OTTHUMT00000157074 ; ARHGAP8-003; intron 3
OTTHUMT00000157075 ; ARHGAP8-004; intron 3
OTTHUMT00000157077 ; PRR5-ARHGAP8-004; intron 4
OTTHUMT00000363127 ; PRR5-ARHGAP8-003; intron 4
OTTHUMT00000321700 ; ARHGAP8-012; intron 4
OTTHUMT00000321698 ; ARHGAP8-010; intron 5
OTTHUMT00000363126 ; PRR5-ARHGAP8-002; intron 6
OTTHUMT00000363125 ; PRR5-ARHGAP8-001; intron 9
ENST00000389772 ; ARHGAP8-005; intron 1
ENST00000498310 ; ARHGAP8-014; intron 1
ENST00000495219 ; ARHGAP8-017; intron 2
ENST00000389774 ; ARHGAP8-001; intron 3
ENST00000460809 ; ARHGAP8-002; intron 3
ENST00000447333 ; ARHGAP8-013; intron 3
ENST00000336963 ; ARHGAP8-003; intron 3
ENST00000356099 ; ARHGAP8-004; intron 3
ENST00000495250 ; PRR5-ARHGAP8-004; intron 4
ENST00000515632 ; PRR5-ARHGAP8-003; intron 4
ENST00000396119 ; ARHGAP8-012; intron 4
ENST00000412433 ; ARHGAP8-010; intron 5
ENST00000361473 ; PRR5-ARHGAP8-002; intron 6
ENST00000389773 ; ARHGAP8-201; intron 6
ENST00000352766 ; PRR5-ARHGAP8-001; intron 9
ENST00000517296 ; ARHGAP8-202; intron 9
Database links

Mature sequence hsa-miR-1249-5p

Accession MIMAT0032029
Sequence

4 - 

aggagggaggagaugggccaaguu

 - 27

Get sequence
Deep sequencing208 reads, 39 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-1249-3p

Accession MIMAT0005901
Previous IDshsa-miR-1249
Sequence

41 - 

acgcccuucccccccuucuuca

 - 62

Get sequence
Deep sequencing4756 reads, 152 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).