Stem-loop sequence hsa-mir-1249

Accession MI0006384
Symbol HGNC:MIR1249
Description Homo sapiens miR-1249 stem-loop
Gene family MIPF0000667; mir-1249
Stem-loop 
----g         a  a  u    caa     cuc 
     ggaggaggg gg ga gggc   guucc   u
     ||||||||| || || ||||   |||||    
     cuucuuccc cc cu cccg   caagg   g
gucca         -  c  u    ---     ucg
Get sequence
Deep sequencing
202 reads, 25 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr22: 45596835-45596900 [-]
sense
OTTHUMT00000321988 ; C22orf9-014; intron 1
OTTHUMT00000321987 ; C22orf9-013; intron 1
OTTHUMT00000321988 ; C22orf9-014; intron 1
OTTHUMT00000321987 ; C22orf9-013; intron 1
OTTHUMT00000321988 ; C22orf9-014; intron 1
OTTHUMT00000321987 ; C22orf9-013; intron 1
OTTHUMT00000321979 ; C22orf9-005; intron 5
OTTHUMT00000321979 ; C22orf9-005; intron 5
OTTHUMT00000321979 ; C22orf9-005; intron 5
OTTHUMT00000321977 ; C22orf9-003; intron 6
OTTHUMT00000321977 ; C22orf9-003; intron 6
OTTHUMT00000321977 ; C22orf9-003; intron 6
OTTHUMT00000321975 ; C22orf9-001; intron 7
OTTHUMT00000321978 ; C22orf9-004; intron 7
OTTHUMT00000321976 ; C22orf9-002; intron 7
OTTHUMT00000321975 ; C22orf9-001; intron 7
OTTHUMT00000321978 ; C22orf9-004; intron 7
OTTHUMT00000321976 ; C22orf9-002; intron 7
OTTHUMT00000321975 ; C22orf9-001; intron 7
OTTHUMT00000321978 ; C22orf9-004; intron 7
OTTHUMT00000321976 ; C22orf9-002; intron 7
ENST00000474515 ; KIAA0930-014; intron 1
ENST00000493003 ; KIAA0930-013; intron 1
ENST00000474515 ; KIAA0930-014; intron 1
ENST00000493003 ; KIAA0930-013; intron 1
ENST00000474515 ; KIAA0930-014; intron 1
ENST00000493003 ; KIAA0930-013; intron 1
ENST00000423262 ; KIAA0930-005; intron 5
ENST00000423262 ; KIAA0930-005; intron 5
ENST00000423262 ; KIAA0930-005; intron 5
ENST00000488038 ; KIAA0930-003; intron 6
ENST00000488038 ; KIAA0930-003; intron 6
ENST00000488038 ; KIAA0930-003; intron 6
ENST00000336156 ; KIAA0930-001; intron 7
ENST00000251993 ; KIAA0930-004; intron 7
ENST00000391627 ; KIAA0930-002; intron 7
ENST00000443310 ; KIAA0930-201; intron 7
ENST00000336156 ; KIAA0930-001; intron 7
ENST00000251993 ; KIAA0930-004; intron 7
ENST00000391627 ; KIAA0930-002; intron 7
ENST00000443310 ; KIAA0930-201; intron 7
ENST00000336156 ; KIAA0930-001; intron 7
ENST00000251993 ; KIAA0930-004; intron 7
ENST00000391627 ; KIAA0930-002; intron 7
ENST00000443310 ; KIAA0930-201; intron 7
Database links

Mature sequence hsa-miR-1249

Accession MIMAT0005901
Sequence

41 -  

acgcccuucccccccuucuuca

 - 62

Get sequence
Deep sequencing 157 reads, 23 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).