Stem-loop sequence hsa-mir-1247

AccessionMI0006382 (change log)
Symbol HGNC:MIR1247
DescriptionHomo sapiens miR-1247 stem-loop
Gene family MIPF0000669; mir-1247
Literature search

20 open access papers mention hsa-mir-1247
(147 sentences)

Stem-loop
   c    u  -    ---c  a   c  cccc   -  --c       a  c   c  uu   c     ac  ugc 
5'  cgcu gc cucg    cc gcg ag    ggc cg   ugggcgc cc guc cg  cgu cccgg  gu   u
    |||| || ||||    || ||| ||    ||| ||   ||||||| || ||| ||  ||| |||||  ||    
3'  gcgg cg gagc    gg cgc uc    ccg gu   gcccgcg gg cag gc  gca gggcc  ca   c
   -    -  a    ccca  -   u  --ca   a  caa       a  u   a  -u   a     -c  ucu 
Get sequence
Deep sequencing
7284 reads, 25.9 reads per million, 139 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101560287-101560422 [-]
intergenic
Database links

Mature sequence hsa-miR-1247-5p

Accession MIMAT0005899
Previous IDshsa-miR-1247
Sequence

40 - 

acccgucccguucguccccgga

 - 61

Get sequence
Deep sequencing6124 reads, 136 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-1247-3p

Accession MIMAT0022721
Sequence

74 - 

ccccgggaacgucgagacuggagc

 - 97

Get sequence
Deep sequencing1079 reads, 109 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).