Stem-loop sequence hsa-mir-1247

Accession

MI0006382

Symbol

HGNC:MIR1247

Description

Homo sapiens miR-1247 stem-loop

Gene family

MIPF0000669; mir-1247

Stem-loop

c    u  -    ---c  a   c  cccc   -  --c       a  c   c  uu   c     ac  ugc 
 cgcu gc cucg    cc gcg ag    ggc cg   ugggcgc cc guc cg  cgu cccgg  gu   u
 |||| || ||||    || ||| ||    ||| ||   ||||||| || ||| ||  ||| |||||  ||    
 gcgg cg gagc    gg cgc uc    ccg gu   gcccgcg gg cag gc  gca gggcc  ca   c
-    -  a    ccca  -   u  --ca   a  caa       a  u   a  -u   a     -c  ucu 

Deep sequencing

235 reads, 16 experiments

Genome context

• Coordinates (GRCh37.p5): chr14: 102026624-102026759 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000414721 ; DIO3OS-001; exon 1

  OTTHUMT00000414729 ; DIO3OS-009; exon 1

  OTTHUMT00000414730 ; DIO3OS-006; exon 1

  OTTHUMT00000414731 ; DIO3OS-007; exon 1

  OTTHUMT00000414732 ; DIO3OS-008; exon 1

  OTTHUMT00000414733 ; DIO3OS-002; exon 1

  OTTHUMT00000414734 ; DIO3OS-003; exon 1

  OTTHUMT00000414736 ; DIO3OS-014; exon 1

  OTTHUMT00000414721 ; DIO3OS-001; exon 1

  OTTHUMT00000414729 ; DIO3OS-009; exon 1

  OTTHUMT00000414730 ; DIO3OS-006; exon 1

  OTTHUMT00000414731 ; DIO3OS-007; exon 1

  OTTHUMT00000414732 ; DIO3OS-008; exon 1

  OTTHUMT00000414733 ; DIO3OS-002; exon 1

  OTTHUMT00000414734 ; DIO3OS-003; exon 1

  OTTHUMT00000414735 ; DIO3OS-015; exon 1

  OTTHUMT00000414736 ; DIO3OS-014; exon 1

  OTTHUMT00000414721 ; DIO3OS-001; exon 1

  OTTHUMT00000414729 ; DIO3OS-009; exon 1

  OTTHUMT00000414730 ; DIO3OS-006; exon 1

  OTTHUMT00000414731 ; DIO3OS-007; exon 1

  OTTHUMT00000414732 ; DIO3OS-008; exon 1

  OTTHUMT00000414733 ; DIO3OS-002; exon 1

  OTTHUMT00000414734 ; DIO3OS-003; exon 1

  OTTHUMT00000414735 ; DIO3OS-015; exon 1

  OTTHUMT00000414736 ; DIO3OS-014; exon 1

  ENST00000557109 ; DIO3OS-001; exon 1

  ENST00000554441 ; DIO3OS-009; exon 1

  ENST00000554735 ; DIO3OS-006; exon 1

  ENST00000555174 ; DIO3OS-007; exon 1

  ENST00000557661 ; DIO3OS-008; exon 1

  ENST00000557532 ; DIO3OS-002; exon 1

  ENST00000554694 ; DIO3OS-003; exon 1

  ENST00000553729 ; DIO3OS-014; exon 1

  ENST00000557109 ; DIO3OS-001; exon 1

  ENST00000554441 ; DIO3OS-009; exon 1

  ENST00000554735 ; DIO3OS-006; exon 1

  ENST00000555174 ; DIO3OS-007; exon 1

  ENST00000557661 ; DIO3OS-008; exon 1

  ENST00000557532 ; DIO3OS-002; exon 1

  ENST00000554694 ; DIO3OS-003; exon 1

  ENST00000555882 ; DIO3OS-015; exon 1

  ENST00000553729 ; DIO3OS-014; exon 1

  ENST00000557109 ; DIO3OS-001; exon 1

  ENST00000554441 ; DIO3OS-009; exon 1

  ENST00000554735 ; DIO3OS-006; exon 1

  ENST00000555174 ; DIO3OS-007; exon 1

  ENST00000557661 ; DIO3OS-008; exon 1

  ENST00000557532 ; DIO3OS-002; exon 1

  ENST00000554694 ; DIO3OS-003; exon 1

  ENST00000555882 ; DIO3OS-015; exon 1

  ENST00000553729 ; DIO3OS-014; exon 1

Database links

• ENTREZGENE: 100302145;MIR1247
• HGNC: 35313;MIR1247

Mature sequence hsa-miR-1247-5p

• Accession: MIMAT0005899
• Previous IDs: hsa-miR-1247
• Sequence: 40 - acccgucccguucguccccgga - 61
• Deep sequencing: 117 reads, 11 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1247-5p
  • MICRORNA.ORG:hsa-miR-1247-5p
  • MIRDB:hsa-miR-1247-5p
  • RNA22-HSA:hsa-miR-1247-5p
  • TARGETMINER:hsa-miR-1247-5p
  • TARGETSCAN-VERT:hsa-miR-1247

Mature sequence hsa-miR-1247-3p

• Accession: MIMAT0022721
• Sequence: 74 - ccccgggaacgucgagacuggagc - 97
• Deep sequencing: 117 reads, 13 experiments
• Evidence: not experimental
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1247-3p
  • MIRDB:hsa-miR-1247-3p
  • TARGETMINER:hsa-miR-1247-3p

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).