Stem-loop sequence hsa-mir-1245a

AccessionMI0006380 (change log)
Previous IDshsa-mir-1245
Symbol HGNC:MIR1245A
DescriptionHomo sapiens miR-1245a stem-loop
Gene family MIPF0000620; mir-1245
Literature search

4 open access papers mention hsa-mir-1245a
(45 sentences)

Stem-loop
   a       a               uc   --u  u 
5'  uuuaugu uaggccuuuagauca  uga   gu g
    ||||||| |||||||||||||||  |||   || a
3'  aaauaua auccggaaaucuagu  auu   ca a
   -       c               ga   ucu  u 
Get sequence
Deep sequencing
207 reads, 0 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 188978092-188978161 [+]
antisense
OTTHUMT00000334695 ; AC068718.1-001; intron 2
ENST00000434418 ; LINC01090-001; intron 2
Clustered miRNAs
< 10kb from hsa-mir-1245a
hsa-mir-1245achr2: 188978092-188978161 [+]
hsa-mir-1245bchr2: 188978093-188978161 [-]
Database links

Mature sequence hsa-miR-1245a

Accession MIMAT0005897
Previous IDshsa-miR-1245
Sequence

45 - 

aagugaucuaaaggccuacau

 - 65

Get sequence
Deep sequencing127 reads, 52 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).