|
miRBase |
|
Stem-loop sequence hsa-mir-1245a |
||||||
| Accession | MI0006380 | |||||
| Previous IDs | hsa-mir-1245 | |||||
| Symbol | HGNC:MIR1245 | |||||
| Description | Homo sapiens miR-1245a stem-loop | |||||
| Gene family | MIPF0000620; mir-1245 | |||||
| Stem-loop |
a a uc --u u uuuaugu uaggccuuuagauca uga gu g ||||||| ||||||||||||||| ||| || a aaauaua auccggaaaucuagu auu ca a - c ga ucu u |
|||||
| Deep sequencing |
| |||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links | ||||||
Mature sequence hsa-miR-1245a |
|
| Accession | MIMAT0005897 |
| Previous IDs | hsa-miR-1245 |
| Sequence |
45 - aagugaucuaaaggccuacau - 65 |
| Deep sequencing | 4 reads, 1 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|