|
miRBase |
|
Stem-loop sequence hsa-mir-1244-1 |
|||||
| Accession | MI0006379 | ||||
| Previous IDs | hsa-mir-1244 | ||||
| Symbol | HGNC:MIR1244 | ||||
| Description | Homo sapiens miR-1244-1 stem-loop | ||||
| Gene family | MIPF0000569; mir-1244 | ||||
| Stem-loop |
--------- uccga uu ua uuuuug u uu
aucuuau gca ccag acu ugua guac a
||||||| ||| |||| ||| |||| ||||
uagagua ugu gguu uga auau caug g
aaaaauugg ----- uu ga ------ - uc
|
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-1244 |
|
| Accession | MIMAT0005896 |
| Sequence |
55 - aaguaguugguuuguaugagaugguu - 80 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|