Stem-loop sequence hsa-mir-1243

Accession MI0006373
Symbol HGNC:MIR1243
Description Homo sapiens miR-1243 stem-loop
Stem-loop 
-------c     c     ca     ag   ug  a   -----    cca 
        uaaaa uggau  auuau  gag  aa uaa     aggu   u
        ||||| |||||  |||||  |||  || |||     ||||   c
        auuuu aucua  uaaug  uuc  uu auu     uccg   u
ccaagaaa     u     aa     gu   gu  c   auuua    ucc
Get sequence
Deep sequencing
3 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr4: 114028019-114028111 [+]
sense
OTTHUMT00000365337 ; ANK2-005; intron 1
OTTHUMT00000256423 ; ANK2-002; intron 1
OTTHUMT00000256422 ; ANK2-001; intron 1
OTTHUMT00000386954 ; ANK2-026; intron 1
OTTHUMT00000365337 ; ANK2-005; intron 1
OTTHUMT00000256423 ; ANK2-002; intron 1
OTTHUMT00000256422 ; ANK2-001; intron 1
OTTHUMT00000386954 ; ANK2-026; intron 1
OTTHUMT00000365337 ; ANK2-005; intron 1
OTTHUMT00000256423 ; ANK2-002; intron 1
OTTHUMT00000256422 ; ANK2-001; intron 1
OTTHUMT00000386954 ; ANK2-026; intron 1
OTTHUMT00000365341 ; ANK2-009; intron 2
OTTHUMT00000365342 ; ANK2-010; intron 2
OTTHUMT00000365336 ; ANK2-004; intron 2
OTTHUMT00000365341 ; ANK2-009; intron 2
OTTHUMT00000365342 ; ANK2-010; intron 2
OTTHUMT00000365336 ; ANK2-004; intron 2
OTTHUMT00000365341 ; ANK2-009; intron 2
OTTHUMT00000365342 ; ANK2-010; intron 2
OTTHUMT00000365336 ; ANK2-004; intron 2
ENST00000504454 ; ANK2-005; intron 1
ENST00000394537 ; ANK2-002; intron 1
ENST00000357077 ; ANK2-001; intron 1
ENST00000264366 ; ANK2-026; intron 1
ENST00000431447 ; ANK2-202; intron 1
ENST00000504454 ; ANK2-005; intron 1
ENST00000394537 ; ANK2-002; intron 1
ENST00000357077 ; ANK2-001; intron 1
ENST00000264366 ; ANK2-026; intron 1
ENST00000431447 ; ANK2-202; intron 1
ENST00000504454 ; ANK2-005; intron 1
ENST00000394537 ; ANK2-002; intron 1
ENST00000357077 ; ANK2-001; intron 1
ENST00000264366 ; ANK2-026; intron 1
ENST00000503271 ; ANK2-009; intron 2
ENST00000503423 ; ANK2-010; intron 2
ENST00000506722 ; ANK2-004; intron 2
ENST00000503271 ; ANK2-009; intron 2
ENST00000503423 ; ANK2-010; intron 2
ENST00000506722 ; ANK2-004; intron 2
ENST00000503271 ; ANK2-009; intron 2
ENST00000503423 ; ANK2-010; intron 2
ENST00000506722 ; ANK2-004; intron 2
Database links

Mature sequence hsa-miR-1243

Accession MIMAT0005894
Sequence

5 -  

aacuggaucaauuauaggagug

 - 26

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).