Stem-loop sequence hsa-mir-1243

AccessionMI0006373 (change log)
Symbol HGNC:MIR1243
DescriptionHomo sapiens miR-1243 stem-loop
Gene family MIPF0001821; mir-1243
Stem-loop
   -------c     c     ca     ag   ug  a   -----    cca 
5'         uaaaa uggau  auuau  gag  aa uaa     aggu   u
           ||||| |||||  |||||  |||  || |||     ||||   c
3'         auuuu aucua  uaaug  uuc  uu auu     uccg   u
   ccaagaaa     u     aa     gu   gu  c   auuua    ucc 
Get sequence
Deep sequencing
337 reads, 0 reads per million, 23 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 113106863-113106955 [+]
sense
OTTHUMT00000256325 ; C4orf32-001; intron 1
ENST00000309733 ; C4orf32-001; intron 1
Database links

Mature sequence hsa-miR-1243

Accession MIMAT0005894
Sequence

5 - 

aacuggaucaauuauaggagug

 - 26

Get sequence
Deep sequencing335 reads, 22 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).