Stem-loop sequence hsa-mir-1305

Accession MI0006372
Symbol HGNC:MIR1305
Description Homo sapiens miR-1305 stem-loop
Gene family MIPF0000965; mir-1305
Stem-loop 
--aa               a       uu     uguu    g 
    gauccugcuguuucu ccauuag  uugaa    uauu u
    ||||||||||||||| |||||||  |||||    |||| a
    uuaggacgacagaga gguaauc  aacuu    auag a
ccuc               g       uc     -uuc    a
Get sequence
Deep sequencing
24 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr4: 183090446-183090531 [+]
sense
OTTHUMT00000361735 ; ODZ3-002; intron 1
OTTHUMT00000361737 ; ODZ3-004; intron 1
OTTHUMT00000361751 ; RP11-402C9.1-001; intron 1
OTTHUMT00000361735 ; ODZ3-002; intron 1
OTTHUMT00000361737 ; ODZ3-004; intron 1
OTTHUMT00000361751 ; RP11-402C9.1-001; intron 1
OTTHUMT00000361735 ; ODZ3-002; intron 1
OTTHUMT00000361737 ; ODZ3-004; intron 1
OTTHUMT00000361751 ; RP11-402C9.1-001; intron 1
ENST00000513201 ; ODZ3-002; intron 1
ENST00000512480 ; ODZ3-004; intron 1
ENST00000505389 ; RP11-402C9.1-001; intron 1
ENST00000513201 ; ODZ3-002; intron 1
ENST00000512480 ; ODZ3-004; intron 1
ENST00000505389 ; RP11-402C9.1-001; intron 1
ENST00000513201 ; ODZ3-002; intron 1
ENST00000512480 ; ODZ3-004; intron 1
ENST00000505389 ; RP11-402C9.1-001; intron 1
Database links

Mature sequence hsa-miR-1305

Accession MIMAT0005893
Sequence

51 -  

uuuucaacucuaaugggagaga

 - 72

Get sequence
Deep sequencing 24 reads, 2 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).