|
miRBase |
|
Stem-loop sequence hsa-mir-1304 |
|||||
| Accession | MI0006371 | ||||
| Symbol | HGNC:MIR1304 | ||||
| Description | Homo sapiens miR-1304 stem-loop | ||||
| Gene family | MIPF0001064; mir-1304 | ||||
| Stem-loop |
--aaa c au
cacuugagcccag gguuugaggcuacagugagaugug c
||||||||||||| |||||||||||||||||||||||| c
gugaacucggguc ccaagcuccgaugucacucuacac u
acuua c cg
|
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-1304-5p |
|
| Accession | MIMAT0005892 |
| Previous IDs | hsa-miR-1304 |
| Sequence |
20 - uuugaggcuacagugagaugug - 41 |
| Deep sequencing | 171 reads, 15 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
Mature sequence hsa-miR-1304-3p |
|
| Accession | MIMAT0022720 |
| Sequence |
53 - ucucacuguagccucgaacccc - 74 |
| Deep sequencing | 325 reads, 13 experiments |
| Evidence | not experimental |
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|