![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1303 |
|||||
Accession | MI0006370 (change log) | ||||
Symbol | HGNC:MIR1303 | ||||
Description | Homo sapiens miR-1303 stem-loop | ||||
Gene family | MIPF0000608; mir-1303 | ||||
Literature search |
![]()
10 open access papers mention hsa-mir-1303 | ||||
Stem-loop |
-- g u aa c uuuu 5' ggcu ggcaaca agcgagaccuc cucua aauuu u |||| ||||||| ||||||||||| ||||| ||||| 3' ucgg ccguugu ucguucugggg gagau uuaaa u uu a c ca u uuuu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-1303 |
|
Accession | MIMAT0005891 |
Sequence |
52 - uuuagagacggggucuugcucu - 73 |
Deep sequencing | 4145 reads, 154 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|