Stem-loop sequence hsa-mir-1302-8

Accession

MI0006369

Symbol

HGNC:MIR1302-8

Description

Homo sapiens miR-1302-8 stem-loop

Gene family

MIPF0000456; mir-1302

Stem-loop

--        a   u        u  a       --       -c     u     a  a  ugc 
  cccauuua acu gaauuuca au aacaccg  uaauuuu  agcau agugu uc ca   a
  |||||||| ||| |||||||| || |||||||  |||||||  ||||| ||||| || ||   g
  ggguagau uga cuuaaagu ua uuguggu  auuaaaa  ucgua ucaua ag gu   u
ac        g   c        c  g       gg       aa     u     c  g  uua 

Deep sequencing

2 reads, 1 experiments

Genome context

• Coordinates (GRCh37.p5): chr9: 100125836-100125963 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000392370 ; C9orf174-013; intron 1

  OTTHUMT00000392370 ; C9orf174-013; intron 1

  OTTHUMT00000392370 ; C9orf174-013; intron 1

  OTTHUMT00000383515 ; C9orf174-001; intron 28

  OTTHUMT00000383515 ; C9orf174-001; intron 28

  OTTHUMT00000383515 ; C9orf174-001; intron 28

  OTTHUMT00000392363 ; RP11-23J9.4-004; intron 32

  OTTHUMT00000392363 ; RP11-23J9.4-004; intron 32

  OTTHUMT00000392363 ; RP11-23J9.4-004; intron 32

  OTTHUMT00000392362 ; RP11-23J9.4-003; intron 35

  OTTHUMT00000392362 ; RP11-23J9.4-003; intron 35

  OTTHUMT00000392362 ; RP11-23J9.4-003; intron 35

  OTTHUMT00000392360 ; RP11-23J9.4-001; intron 40

  OTTHUMT00000392361 ; RP11-23J9.4-002; intron 40

  OTTHUMT00000392360 ; RP11-23J9.4-001; intron 40

  OTTHUMT00000392361 ; RP11-23J9.4-002; intron 40

  OTTHUMT00000392360 ; RP11-23J9.4-001; intron 40

  OTTHUMT00000392361 ; RP11-23J9.4-002; intron 40

  ENST00000527182 ; C9orf174-013; intron 1

  ENST00000527182 ; C9orf174-013; intron 1

  ENST00000527182 ; C9orf174-013; intron 1

  ENST00000541524 ; C9orf174-206; intron 27

  ENST00000541524 ; C9orf174-206; intron 27

  ENST00000529487 ; C9orf174-001; intron 28

  ENST00000529487 ; C9orf174-001; intron 28

  ENST00000529487 ; C9orf174-001; intron 28

  ENST00000529787 ; RP11-23J9.4-004; intron 32

  ENST00000529787 ; RP11-23J9.4-004; intron 32

  ENST00000529787 ; RP11-23J9.4-004; intron 32

  ENST00000532526 ; RP11-23J9.4-003; intron 35

  ENST00000532526 ; RP11-23J9.4-003; intron 35

  ENST00000532526 ; RP11-23J9.4-003; intron 35

  ENST00000395220 ; C9orf174-204; intron 39

  ENST00000395220 ; C9orf174-204; intron 39

  ENST00000395220 ; C9orf174-204; intron 39

  ENST00000357054 ; C9orf174-201; intron 40

  ENST00000375206 ; RP11-23J9.4-001; intron 40

  ENST00000534123 ; RP11-23J9.4-002; intron 40

  ENST00000357054 ; C9orf174-201; intron 40

  ENST00000375206 ; RP11-23J9.4-001; intron 40

  ENST00000534123 ; RP11-23J9.4-002; intron 40

  ENST00000357054 ; C9orf174-201; intron 40

  ENST00000375206 ; RP11-23J9.4-001; intron 40

  ENST00000534123 ; RP11-23J9.4-002; intron 40

  ENST00000375202 ; C9orf174-202; intron 42

  ENST00000375202 ; C9orf174-202; intron 42

  ENST00000375202 ; C9orf174-202; intron 42

Database links

• ENTREZGENE: 100302223;MIR1302-8
• HGNC: 35300;MIR1302-8

Mature sequence hsa-miR-1302

• Accession: MIMAT0005890
• Sequence: 66 - uugggacauacuuaugcuaaa - 86
• Deep sequencing: 18 reads, 1 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1302
  • MICRORNA.ORG:hsa-miR-1302
  • MIRDB:hsa-miR-1302
  • RNA22-HSA:hsa-miR-1302
  • TARGETMINER:hsa-miR-1302
  • TARGETSCAN-VERT:hsa-miR-1302

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).