Stem-loop sequence hsa-mir-1302-8

AccessionMI0006369 (change log)
Symbol HGNC:MIR1302-8
DescriptionHomo sapiens miR-1302-8 stem-loop
Gene family MIPF0000456; mir-1302
Literature search

7 open access papers mention hsa-mir-1302-8
(87 sentences)

Stem-loop
   --        a   u        u  a       --       -c     u     a  a  ugc 
5'   cccauuua acu gaauuuca au aacaccg  uaauuuu  agcau agugu uc ca   a
     |||||||| ||| |||||||| || |||||||  |||||||  ||||| ||||| || ||   g
3'   ggguagau uga cuuaaagu ua uuguggu  auuaaaa  ucgua ucaua ag gu   u
   ac        g   c        c  g       gg       aa     u     c  g  uua 
Get sequence
Deep sequencing
71 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 97363554-97363681 [-]
intergenic
Database links

Mature sequence hsa-miR-1302

Accession MIMAT0005890
Sequence

66 - 

uugggacauacuuaugcuaaa

 - 86

Get sequence
Deep sequencing653 reads, 33 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).