|
miRBase |
|
Stem-loop sequence hsa-mir-1302-7 |
|||||
| Accession | MI0006368 | ||||
| Symbol | HGNC:MIR1302-7 | ||||
| Description | Homo sapiens miR-1302-7 stem-loop | ||||
| Gene family | MIPF0000456; mir-1302 | ||||
| Stem-loop |
ac ----g g cau g ugc aacau uuuuuag a guaugucu g a ||||| ||||||| | |||||||| | a uugug aaaaauc u cauacagg u u -c auuaa g auu g uaa |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-1302 |
|
| Accession | MIMAT0005890 |
| Sequence |
39 - uugggacauacuuaugcuaaa - 59 |
| Deep sequencing | 18 reads, 1 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|