Stem-loop sequence hsa-mir-1302-7

AccessionMI0006368 (change log)
Symbol HGNC:MIR1302-7
DescriptionHomo sapiens miR-1302-7 stem-loop
Gene family MIPF0000456; mir-1302
Literature search

7 open access papers mention hsa-mir-1302-7
(88 sentences)

Stem-loop
   ac     ----g       g cau        g ugc 
5'   aacau     uuuuuag a   guaugucu g   a
     |||||     ||||||| |   |||||||| |   a
3'   uugug     aaaaauc u   cauacagg u   u
   -c     auuaa       g auu        g uaa 
Get sequence
Deep sequencing
94 reads, 29.8 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 141786242-141786313 [-]
sense
OTTHUMT00000378057 ; PTK2-002; intron 3
OTTHUMT00000378067 ; PTK2-009; intron 3
OTTHUMT00000378366 ; PTK2-049; intron 3
OTTHUMT00000378369 ; PTK2-052; intron 3
OTTHUMT00000378175 ; PTK2-026; intron 3
OTTHUMT00000378056 ; PTK2-003; intron 8
OTTHUMT00000378068 ; PTK2-010; intron 12
OTTHUMT00000378104 ; PTK2-013; intron 12
OTTHUMT00000378062 ; PTK2-008; intron 13
OTTHUMT00000378054 ; PTK2-001; intron 14
OTTHUMT00000378540 ; PTK2-057; intron 14
OTTHUMT00000378103 ; PTK2-011; intron 14
OTTHUMT00000378063 ; PTK2-007; intron 14
ENST00000523539 ; PTK2-002; intron 3
ENST00000521986 ; PTK2-009; intron 3
ENST00000521250 ; PTK2-049; intron 3
ENST00000521981 ; PTK2-052; intron 3
ENST00000523746 ; PTK2-026; intron 3
ENST00000538769 ; PTK2-203; intron 3
ENST00000524202 ; PTK2-003; intron 8
ENST00000519654 ; PTK2-010; intron 12
ENST00000519993 ; PTK2-013; intron 12
ENST00000535192 ; PTK2-202; intron 12
ENST00000517887 ; PTK2-008; intron 13
ENST00000522684 ; PTK2-001; intron 14
ENST00000521059 ; PTK2-057; intron 14
ENST00000340930 ; PTK2-011; intron 14
ENST00000519419 ; PTK2-007; intron 14
ENST00000395218 ; PTK2-201; intron 14
Database links

Mature sequence hsa-miR-1302

Accession MIMAT0005890
Sequence

39 - 

uugggacauacuuaugcuaaa

 - 59

Get sequence
Deep sequencing653 reads, 33 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).