Stem-loop sequence hsa-mir-1302-6

AccessionMI0006367 (change log)
Symbol HGNC:MIR1302-6
DescriptionHomo sapiens miR-1302-6 stem-loop
Gene family MIPF0000456; mir-1302
Literature search

6 open access papers mention hsa-mir-1302-6
(87 sentences)

Stem-loop
   --        a   gg  a    u     g    cac      uag 
5'   aacaaaua uuu  ua uaua guaug ccca   aauauu   g
     |||||||| |||  || |||| ||||| ||||   ||||||   a
3'   uuguuuau aaa  au guau cauac gggu   uuauaa   c
   ag        g   aa  c    u     a    ---      caa 
Get sequence
Deep sequencing
61 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 18127220-18127309 [-]
antisense
OTTHUMT00000326646 ; HDAC9-005; intron 1
ENST00000417496 ; HDAC9-005; intron 1
Database links

Mature sequence hsa-miR-1302

Accession MIMAT0005890
Sequence

56 - 

uugggacauacuuaugcuaaa

 - 76

Get sequence
Deep sequencing653 reads, 33 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).