Stem-loop sequence hsa-mir-1302-5

AccessionMI0006366 (change log)
Symbol HGNC:MIR1302-5
DescriptionHomo sapiens miR-1302-5 stem-loop
Gene family MIPF0000456; mir-1302
Literature search

6 open access papers mention hsa-mir-1302-5
(89 sentences)

Stem-loop
   ----ugcccg    cccauu       uu    ----a     auc    au      a           a     ugu 
5'           gccu      aaauugg  uuuc     gacaa   acaa  uuguuu gguauaaguau uccca   a
             ||||      |||||||  ||||     |||||   ||||  |||||| ||||||||||| |||||   a
3'           ugga      uuuaauu  aaag     uuguu   uguu  aauaaa ucguauucaua agggu   u
   uuauguccug    -uuaau       uu    guuag     ccu    --      a           c     uuc 
Get sequence
Deep sequencing
69 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 50614636-50614785 [-]
intergenic
Database links

Mature sequence hsa-miR-1302

Accession MIMAT0005890
Sequence

77 - 

uugggacauacuuaugcuaaa

 - 97

Get sequence
Deep sequencing653 reads, 33 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).