Stem-loop sequence hsa-mir-1302-4

AccessionMI0006365 (change log)
Symbol HGNC:MIR1302-4
DescriptionHomo sapiens miR-1302-4 stem-loop
Gene family MIPF0000456; mir-1302
Literature search

7 open access papers mention hsa-mir-1302-4
(88 sentences)

Stem-loop
   --       -aa ca   cuaa                ---aa      uu -uc    a           u   ugc 
5'   aaugcag   g  cag    aauuugaauuucagau     acaaau  u   uuag auaaguauguc cca   a
     |||||||   |  |||    ||||||||||||||||     ||||||  |   |||| ||||||||||| |||   a
3'   uuauguc   c  guc    uuaaacuuaaagucua     uguuua  a   aauc uauucauacag ggu   c
   uu       cua ag   -aac                cuuug      uu uaa    g           -   uua 
Get sequence
Deep sequencing
122 reads, 1.92 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 207269275-207269424 [-]
intergenic
Database links

Mature sequence hsa-miR-1302

Accession MIMAT0005890
Sequence

77 - 

uugggacauacuuaugcuaaa

 - 97

Get sequence
Deep sequencing653 reads, 33 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).