Stem-loop sequence hsa-mir-1302-2

AccessionMI0006363 (change log)
Symbol HGNC:MIR1302-2
DescriptionHomo sapiens miR-1302-2 stem-loop
Gene family MIPF0000456; mir-1302
Literature search

9 open access papers mention hsa-mir-1302-2
(102 sentences)

   ggaugccca   --ag                     g      --uucg        a              
5'          gcu    uuugaauuuuagauaaacaac aauaau      uagcauaa uaugucccaagcu 
            |||    ||||||||||||||||||||| ||||||      |||||||| |||||||||||| u
3'          cga    agacuuagagucuauuuguug uuauua      aucguauu auacaggguuuga 
   ---auuuua   auua                     g      caaaaa        c              
Get sequence
Deep sequencing
92 reads, 2.22 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 30366-30503 [+]
OTTHUMT00000002840 ; RP11-34P13.3-001; intron 1
OTTHUMT00000002841 ; RP11-34P13.3-002; exon 1
ENST00000473358 ; MIR1302-10-001; intron 1
ENST00000469289 ; MIR1302-10-002; exon 1
Database links

Mature sequence hsa-miR-1302

Accession MIMAT0005890

73 - 


 - 93

Get sequence
Deep sequencing653 reads, 33 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets


PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).