Stem-loop sequence hsa-mir-548l

AccessionMI0006361 (change log)
Symbol HGNC:MIR548L
DescriptionHomo sapiens miR-548l stem-loop
Gene family MIPF0000317; mir-548
Literature search

42 open access papers mention hsa-mir-548l
(143 sentences)

Stem-loop
   --uauua          a     u      g         aga 
5'        gguuggugca aagua uugcgg uuuugucgu   a
          |||||||||| ||||| |||||| |||||||||    
3'        ccaaccacgu uucau gacguc aaaacggua   a
   ucguaaa          g     u      a         aug 
Get sequence
Deep sequencing
6084 reads, 8.73 reads per million, 126 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 94466495-94466580 [-]
sense
OTTHUMT00000396436 ; RP11-867G2.8-001; intron 1
OTTHUMT00000396437 ; RP11-867G2.8-002; intron 1
ENST00000536540 ; RP11-867G2.8-001; intron 1
ENST00000537874 ; RP11-867G2.8-002; intron 1
antisense
OTTHUMT00000397842 ; AMOTL1-007; intron 2
ENST00000299004 ; AMOTL1-007; intron 2
Database links

Mature sequence hsa-miR-548l

Accession MIMAT0005889
Sequence

15 - 

aaaaguauuugcggguuuuguc

 - 36

Get sequence
Deep sequencing2117 reads, 109 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).