Stem-loop sequence hsa-mir-548l

Accession

MI0006361

Symbol

HGNC:MIR548L

Description

Homo sapiens miR-548l stem-loop

Gene family

MIPF0000317; mir-548

Stem-loop

--uauua          a     u      g         aga 
       gguuggugca aagua uugcgg uuuugucgu   a
       |||||||||| ||||| |||||| |||||||||    
       ccaaccacgu uucau gacguc aaaacggua   a
ucguaaa          g     u      a         aug 

Deep sequencing

101 reads, 14 experiments

Genome context

• Coordinates (GRCh37.p5): chr11: 94199661-94199746 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000396237 ; MRE11A-001; intron 10

  OTTHUMT00000396234 ; MRE11A-004; intron 10

  OTTHUMT00000396235 ; MRE11A-002; intron 10

  OTTHUMT00000396236 ; MRE11A-006; intron 10

  OTTHUMT00000396238 ; MRE11A-003; intron 10

  OTTHUMT00000396237 ; MRE11A-001; intron 10

  OTTHUMT00000396234 ; MRE11A-004; intron 10

  OTTHUMT00000396235 ; MRE11A-002; intron 10

  OTTHUMT00000396236 ; MRE11A-006; intron 10

  OTTHUMT00000396238 ; MRE11A-003; intron 10

  OTTHUMT00000396237 ; MRE11A-001; intron 10

  OTTHUMT00000396234 ; MRE11A-004; intron 10

  OTTHUMT00000396235 ; MRE11A-002; intron 10

  OTTHUMT00000396236 ; MRE11A-006; intron 10

  OTTHUMT00000396238 ; MRE11A-003; intron 10

  ENST00000323929 ; MRE11A-001; intron 10

  ENST00000407439 ; MRE11A-004; intron 10

  ENST00000323977 ; MRE11A-002; intron 10

  ENST00000393241 ; MRE11A-006; intron 10

  ENST00000536550 ; MRE11A-003; intron 10

  ENST00000323929 ; MRE11A-001; intron 10

  ENST00000407439 ; MRE11A-004; intron 10

  ENST00000323977 ; MRE11A-002; intron 10

  ENST00000393241 ; MRE11A-006; intron 10

  ENST00000536550 ; MRE11A-003; intron 10

  ENST00000323929 ; MRE11A-001; intron 10

  ENST00000407439 ; MRE11A-004; intron 10

  ENST00000323977 ; MRE11A-002; intron 10

  ENST00000393241 ; MRE11A-006; intron 10

  ENST00000536550 ; MRE11A-003; intron 10

Database links

• ENTREZGENE: 100302275;MIR548L
• ENTREZGENE: 100313825;MIR548L
• HGNC: 35292;MIR548L

Mature sequence hsa-miR-548l

• Accession: MIMAT0005889
• Sequence: 15 - aaaaguauuugcggguuuuguc - 36
• Deep sequencing: 30 reads, 6 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-548l
  • MICRORNA.ORG:hsa-miR-548l
  • MIRDB:hsa-miR-548l
  • RNA22-HSA:hsa-miR-548l
  • TARGETMINER:hsa-miR-548l
  • TARGETSCAN-VERT:hsa-miR-548l

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).