|
miRBase |
|
Stem-loop sequence hsa-mir-1299 |
|||||
| Accession | MI0006359 | ||||
| Symbol | HGNC:MIR1299 | ||||
| Description | Homo sapiens miR-1299 stem-loop | ||||
| Gene family | MIPF0000625; mir-1299 | ||||
| Stem-loop |
-- g u ug ---c a gacaau ccucaug cag guuc gaau cuacgug gg c ||||||| ||| |||| |||| ||||||| || ggagugu guc uaag cuug gaugcac cc a ag - u gu ugac - agacuu |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-1299 |
|
| Accession | MIMAT0005887 |
| Sequence |
62 - uucuggaauucugugugaggga - 83 |
| Deep sequencing | 344 reads, 11 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|