Stem-loop sequence hsa-mir-1295a

AccessionMI0006357 (change log)
Previous IDshsa-mir-1295
Symbol HGNC:MIR1295A
DescriptionHomo sapiens miR-1295a stem-loop
Gene family MIPF0000676; mir-1295
Stem-loop
   --         ug        c        u   g aau 
5'   aggacauuu  cccagauc guggccua uca a   g
     |||||||||  |||||||| |||||||| ||| |   u
3'   uccuguaaa  gggucuag cgccggau agu u   g
   cc         gu        a        u   g ccg 
Get sequence
Deep sequencing
980 reads, 1.09 reads per million, 92 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 171101728-171101806 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-1295a
hsa-mir-1295bchr1: 171101739-171101798 [+]
hsa-mir-1295achr1: 171101728-171101806 [-]
Database links

Mature sequence hsa-miR-1295a

Accession MIMAT0005885
Previous IDshsa-miR-1295
Sequence

49 - 

uuaggccgcagaucuggguga

 - 69

Get sequence
Deep sequencing972 reads, 91 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).