Stem-loop sequence hsa-mir-1294

Accession MI0006356
Symbol HGNC:MIR1294
Description Homo sapiens miR-1294 stem-loop
Gene family MIPF0000603; mir-1294
Stem-loop
--     aaugugug  aa     gu   u  a g       c                          c  g  u 
  caccu        cc  gaucu  uca uu u aucucac gaguccugugagguuggcauuguugu ug ca u
  |||||        ||  |||||  ||| || | ||||||| |||||||||||||||||||||||||| || || g
  gugga        gg  uuagg  agu aa a uggagug cucaggacacuccaaccgugacaaca au gu u
au     -------a  -a     --   c  - g       a                          u  a  c 
Get sequence
Deep sequencing
28 reads, 11 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 153726666-153726807 [+]
sense
OTTHUMT00000374272 ; GALNT10-005; intron 4
OTTHUMT00000252453 ; GALNT10-001; intron 4
OTTHUMT00000374250 ; GALNT10-004; intron 4
OTTHUMT00000374249 ; GALNT10-003; intron 4
OTTHUMT00000374275 ; GALNT10-008; intron 4
OTTHUMT00000374272 ; GALNT10-005; intron 4
OTTHUMT00000252453 ; GALNT10-001; intron 4
OTTHUMT00000374250 ; GALNT10-004; intron 4
OTTHUMT00000374249 ; GALNT10-003; intron 4
OTTHUMT00000374275 ; GALNT10-008; intron 4
OTTHUMT00000374272 ; GALNT10-005; intron 4
OTTHUMT00000252453 ; GALNT10-001; intron 4
OTTHUMT00000374250 ; GALNT10-004; intron 4
OTTHUMT00000374249 ; GALNT10-003; intron 4
OTTHUMT00000374275 ; GALNT10-008; intron 4
OTTHUMT00000374274 ; GALNT10-007; intron 5
OTTHUMT00000374274 ; GALNT10-007; intron 5
OTTHUMT00000374274 ; GALNT10-007; intron 5
ENST00000425427 ; GALNT10-005; intron 4
ENST00000297107 ; GALNT10-001; intron 4
ENST00000520647 ; GALNT10-004; intron 4
ENST00000377661 ; GALNT10-003; intron 4
ENST00000519571 ; GALNT10-008; intron 4
ENST00000425427 ; GALNT10-005; intron 4
ENST00000297107 ; GALNT10-001; intron 4
ENST00000520647 ; GALNT10-004; intron 4
ENST00000377661 ; GALNT10-003; intron 4
ENST00000519571 ; GALNT10-008; intron 4
ENST00000425427 ; GALNT10-005; intron 4
ENST00000297107 ; GALNT10-001; intron 4
ENST00000520647 ; GALNT10-004; intron 4
ENST00000377661 ; GALNT10-003; intron 4
ENST00000519571 ; GALNT10-008; intron 4
ENST00000521781 ; GALNT10-007; intron 5
ENST00000521781 ; GALNT10-007; intron 5
ENST00000521781 ; GALNT10-007; intron 5
antisense
OTTHUMT00000374278 ; CTB-157D17.1-001; intron 2
OTTHUMT00000374278 ; CTB-157D17.1-001; intron 2
OTTHUMT00000374278 ; CTB-157D17.1-001; intron 2
ENST00000519727 ; CTB-157D17.1-001; intron 2
ENST00000519727 ; CTB-157D17.1-001; intron 2
ENST00000519727 ; CTB-157D17.1-001; intron 2
Database links

Mature sequence hsa-miR-1294

Accession MIMAT0005884
Sequence

48 - 

ugugagguuggcauuguugucu

 - 69

Get sequence
Deep sequencing 25 reads, 10 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).