Stem-loop sequence hsa-mir-1293

Accession MI0006355
Symbol HGNC:MIR1293
Description Homo sapiens miR-1293 stem-loop
Gene family MIPF0000691; mir-1293
Stem-loop 
agguuguu                         cu 
        cuggguggucuggagauuugugcag  u
        |||||||||||||||||||||||||  g
        gauucaccaggccucuaaacacguc  u
--auuucu                         ca
Get sequence
Deep sequencing
10 reads, 6 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr12: 50627925-50627995 [-]
sense
OTTHUMT00000406234 ; LIMA1-001; intron 2
OTTHUMT00000406235 ; LIMA1-003; intron 2
OTTHUMT00000406413 ; LIMA1-005; intron 2
OTTHUMT00000406999 ; LIMA1-013; intron 2
OTTHUMT00000407001 ; LIMA1-008; intron 2
OTTHUMT00000406234 ; LIMA1-001; intron 2
OTTHUMT00000406235 ; LIMA1-003; intron 2
OTTHUMT00000406413 ; LIMA1-005; intron 2
OTTHUMT00000406999 ; LIMA1-013; intron 2
OTTHUMT00000407001 ; LIMA1-008; intron 2
OTTHUMT00000406234 ; LIMA1-001; intron 2
OTTHUMT00000406235 ; LIMA1-003; intron 2
OTTHUMT00000406413 ; LIMA1-005; intron 2
OTTHUMT00000406999 ; LIMA1-013; intron 2
OTTHUMT00000407001 ; LIMA1-008; intron 2
OTTHUMT00000407000 ; LIMA1-009; intron 3
OTTHUMT00000407000 ; LIMA1-009; intron 3
OTTHUMT00000407000 ; LIMA1-009; intron 3
ENST00000394943 ; LIMA1-001; intron 2
ENST00000341247 ; LIMA1-003; intron 2
ENST00000552720 ; LIMA1-005; intron 2
ENST00000549681 ; LIMA1-013; intron 2
ENST00000550592 ; LIMA1-008; intron 2
ENST00000394943 ; LIMA1-001; intron 2
ENST00000341247 ; LIMA1-003; intron 2
ENST00000552720 ; LIMA1-005; intron 2
ENST00000549681 ; LIMA1-013; intron 2
ENST00000550592 ; LIMA1-008; intron 2
ENST00000394943 ; LIMA1-001; intron 2
ENST00000341247 ; LIMA1-003; intron 2
ENST00000552720 ; LIMA1-005; intron 2
ENST00000549681 ; LIMA1-013; intron 2
ENST00000550592 ; LIMA1-008; intron 2
ENST00000551691 ; LIMA1-009; intron 3
ENST00000551691 ; LIMA1-009; intron 3
ENST00000551691 ; LIMA1-009; intron 3
Database links

Mature sequence hsa-miR-1293

Accession MIMAT0005883
Sequence

10 -  

uggguggucuggagauuugugc

 - 31

Get sequence
Deep sequencing 7 reads, 4 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).