Stem-loop sequence hsa-mir-1293

AccessionMI0006355 (change log)
Symbol HGNC:MIR1293
DescriptionHomo sapiens miR-1293 stem-loop
Gene family MIPF0000691; mir-1293
Literature search

6 open access papers mention hsa-mir-1293
(9 sentences)

Stem-loop
   agguuguu                         cu 
5'         cuggguggucuggagauuugugcag  u
           |||||||||||||||||||||||||  g
3'         gauucaccaggccucuaaacacguc  u
   --auuucu                         ca 
Get sequence
Deep sequencing
208 reads, 4.76 reads per million, 42 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 50234142-50234212 [-]
sense
OTTHUMT00000405982 ; BCDIN3D-001; intron 1
OTTHUMT00000405983 ; BCDIN3D-002; intron 1
ENST00000333924 ; BCDIN3D-001; intron 1
ENST00000550861 ; BCDIN3D-002; intron 1
antisense
OTTHUMT00000405531 ; RP11-70F11.6-001; exon 3
ENST00000548872 ; BCDIN3D-AS1-001; exon 3
Database links

Mature sequence hsa-miR-1293

Accession MIMAT0005883
Sequence

10 - 

uggguggucuggagauuugugc

 - 31

Get sequence
Deep sequencing173 reads, 36 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).