Stem-loop sequence hsa-mir-548k

AccessionMI0006354 (change log)
Symbol HGNC:MIR548K
DescriptionHomo sapiens miR-548k stem-loop
Gene family MIPF0000317; mir-548
Literature search

42 open access papers mention hsa-mir-548k
(149 sentences)

Stem-loop
   cuuuucucaa      c           u         c      a       uuac 
5'           guauug uguuagguugg gcaaaagua uugcgg uuuugcu    u
             |||||| ||||||||||| ||||||||| |||||| |||||||    u
3'           cguagu auaauccaacu cguuuuuau aacgcc aaaacgg    u
   ucgguuaaaa      -           u         u      a       uaau 
Get sequence
Deep sequencing
8563 reads, 15.8 reads per million, 146 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 70283955-70284070 [+]
intergenic
Database links

Mature sequence hsa-miR-548k

Accession MIMAT0005882
Sequence

32 - 

aaaaguacuugcggauuuugcu

 - 53

Get sequence
Deep sequencing7154 reads, 142 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).