Stem-loop sequence hsa-mir-548k

Accession MI0006354
Symbol HGNC:MIR548K
Description Homo sapiens miR-548k stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
cuuuucucaa      c           u         c      a       uuac 
          guauug uguuagguugg gcaaaagua uugcgg uuuugcu    u
          |||||| ||||||||||| ||||||||| |||||| |||||||    u
          cguagu auaauccaacu cguuuuuau aacgcc aaaacgg    u
ucgguuaaaa      -           u         u      a       uaau
Get sequence
Deep sequencing
442 reads, 15 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 70130061-70130176 [+]
sense
OTTHUMT00000393909 ; PPFIA1-009; intron 1
OTTHUMT00000393909 ; PPFIA1-009; intron 1
OTTHUMT00000393909 ; PPFIA1-009; intron 1
OTTHUMT00000393905 ; PPFIA1-001; intron 2
OTTHUMT00000393906 ; PPFIA1-002; intron 2
OTTHUMT00000393907 ; PPFIA1-003; intron 2
OTTHUMT00000393908 ; PPFIA1-008; intron 2
OTTHUMT00000393905 ; PPFIA1-001; intron 2
OTTHUMT00000393906 ; PPFIA1-002; intron 2
OTTHUMT00000393907 ; PPFIA1-003; intron 2
OTTHUMT00000393908 ; PPFIA1-008; intron 2
OTTHUMT00000393905 ; PPFIA1-001; intron 2
OTTHUMT00000393906 ; PPFIA1-002; intron 2
OTTHUMT00000393907 ; PPFIA1-003; intron 2
OTTHUMT00000393908 ; PPFIA1-008; intron 2
ENST00000532024 ; PPFIA1-009; intron 1
ENST00000532024 ; PPFIA1-009; intron 1
ENST00000532024 ; PPFIA1-009; intron 1
ENST00000253925 ; PPFIA1-001; intron 2
ENST00000389547 ; PPFIA1-002; intron 2
ENST00000532504 ; PPFIA1-003; intron 2
ENST00000530746 ; PPFIA1-008; intron 2
ENST00000544950 ; PPFIA1-201; intron 2
ENST00000253925 ; PPFIA1-001; intron 2
ENST00000389547 ; PPFIA1-002; intron 2
ENST00000532504 ; PPFIA1-003; intron 2
ENST00000530746 ; PPFIA1-008; intron 2
ENST00000544950 ; PPFIA1-201; intron 2
ENST00000253925 ; PPFIA1-001; intron 2
ENST00000389547 ; PPFIA1-002; intron 2
ENST00000532504 ; PPFIA1-003; intron 2
ENST00000530746 ; PPFIA1-008; intron 2
antisense
OTTHUMT00000393963 ; AP000487.6-001; intron 1
OTTHUMT00000393963 ; AP000487.6-001; intron 1
OTTHUMT00000393963 ; AP000487.6-001; intron 1
ENST00000528607 ; AP000487.6-001; intron 1
ENST00000528607 ; AP000487.6-001; intron 1
ENST00000528607 ; AP000487.6-001; intron 1
Database links

Mature sequence hsa-miR-548k

Accession MIMAT0005882
Sequence

32 -  

aaaaguacuugcggauuuugcu

 - 53

Get sequence
Deep sequencing 437 reads, 13 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).