Stem-loop sequence hsa-mir-1291

Accession

MI0006353

Symbol

HGNC:MIR1291

Description

Homo sapiens miR-1291 stem-loop

Gene family

MIPF0000599; mir-1291

Stem-loop

--  u   -au   -agu    -   a  ga           ug   
  gg aga   ucc    ggcc cug cu  agaccagcagu  ua 
  || |||   |||    |||| ||| ||  |||||||||||  | c
  cc ucu   agg    ccgg gac ga  uuugguugucg  gu 
gu  u   guc   aaau    a   -  ac           gu   

Deep sequencing

135 reads, 9 experiments

Genome context

• Coordinates (GRCh37.p5): chr12: 49048227-49048313 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000408842 ; C12orf41-015; intron 2

  OTTHUMT00000408842 ; C12orf41-015; intron 2

  OTTHUMT00000408842 ; C12orf41-015; intron 2

  OTTHUMT00000408843 ; C12orf41-013; intron 4

  OTTHUMT00000408844 ; C12orf41-007; intron 4

  OTTHUMT00000408843 ; C12orf41-013; intron 4

  OTTHUMT00000408844 ; C12orf41-007; intron 4

  OTTHUMT00000408843 ; C12orf41-013; intron 4

  OTTHUMT00000408844 ; C12orf41-007; intron 4

  OTTHUMT00000408838 ; C12orf41-004; intron 6

  OTTHUMT00000408838 ; C12orf41-004; intron 6

  OTTHUMT00000408838 ; C12orf41-004; intron 6

  OTTHUMT00000408839 ; C12orf41-003; intron 8

  OTTHUMT00000408840 ; C12orf41-001; intron 8

  OTTHUMT00000408839 ; C12orf41-003; intron 8

  OTTHUMT00000408840 ; C12orf41-001; intron 8

  OTTHUMT00000408839 ; C12orf41-003; intron 8

  OTTHUMT00000408840 ; C12orf41-001; intron 8

  OTTHUMT00000408841 ; C12orf41-002; intron 9

  OTTHUMT00000408845 ; C12orf41-006; intron 9

  OTTHUMT00000408846 ; C12orf41-005; intron 9

  OTTHUMT00000408841 ; C12orf41-002; intron 9

  OTTHUMT00000408845 ; C12orf41-006; intron 9

  OTTHUMT00000408846 ; C12orf41-005; intron 9

  OTTHUMT00000408841 ; C12orf41-002; intron 9

  OTTHUMT00000408845 ; C12orf41-006; intron 9

  OTTHUMT00000408846 ; C12orf41-005; intron 9

  ENST00000408564 ; SNORA34-201; exon 1

  ENST00000408564 ; SNORA34-201; exon 1

  ENST00000408564 ; SNORA34-201; exon 1

  ENST00000549463 ; C12orf41-015; intron 2

  ENST00000549463 ; KANSL2-015; intron 2

  ENST00000549463 ; KANSL2-015; intron 2

  ENST00000548701 ; C12orf41-013; intron 4

  ENST00000547087 ; C12orf41-007; intron 4

  ENST00000548701 ; KANSL2-013; intron 4

  ENST00000547087 ; KANSL2-007; intron 4

  ENST00000548701 ; KANSL2-013; intron 4

  ENST00000547087 ; KANSL2-007; intron 4

  ENST00000548147 ; C12orf41-004; intron 6

  ENST00000548147 ; KANSL2-004; intron 6

  ENST00000548147 ; KANSL2-004; intron 6

  ENST00000546701 ; C12orf41-003; intron 8

  ENST00000550347 ; C12orf41-001; intron 8

  ENST00000546701 ; KANSL2-003; intron 8

  ENST00000550347 ; KANSL2-001; intron 8

  ENST00000546701 ; KANSL2-003; intron 8

  ENST00000550347 ; KANSL2-001; intron 8

  ENST00000420613 ; C12orf41-002; intron 9

  ENST00000549574 ; C12orf41-006; intron 9

  ENST00000553086 ; C12orf41-005; intron 9

  ENST00000420613 ; KANSL2-002; intron 9

  ENST00000549574 ; KANSL2-006; intron 9

  ENST00000553086 ; KANSL2-005; intron 9

  ENST00000420613 ; KANSL2-002; intron 9

  ENST00000549574 ; KANSL2-006; intron 9

  ENST00000553086 ; KANSL2-005; intron 9

Database links

• ENTREZGENE: 100302221;MIR1291
• HGNC: 35284;MIR1291

Mature sequence hsa-miR-1291

• Accession: MIMAT0005881
• Sequence: 14 - uggcccugacugaagaccagcagu - 37
• Deep sequencing: 135 reads, 9 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1291
  • MICRORNA.ORG:hsa-miR-1291
  • MIRDB:hsa-miR-1291
  • RNA22-HSA:hsa-miR-1291
  • TARGETMINER:hsa-miR-1291
  • TARGETSCAN-VERT:hsa-miR-1291

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).