Stem-loop sequence hsa-mir-1289-2

AccessionMI0006351 (change log)
Symbol HGNC:MIR1289-2
DescriptionHomo sapiens miR-1289-2 stem-loop
Gene family MIPF0000626; mir-1289
Literature search

1 open access papers mention hsa-mir-1289-2
(1 sentences)

Stem-loop
   --ccac   cc   --u      g   c      a   c ug -     -a   a  g 
5'       ggu  uag   uaaaaa gca auuccu gac c  c cucag  acu cu a
         |||  |||   |||||| ||| |||||| ||| |  | |||||  ||| ||  
3'       ccg  auc   auuuuu cgu uaagga cug g  g ggguc  uga ga a
   ccgccc   cu   ccc      a   c      c   a gu u     ac   -  c 
Get sequence
Deep sequencing
119 reads, 41.7 reads per million, 60 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 133427596-133427706 [-]
intergenic
Database links

Mature sequence hsa-miR-1289

Accession MIMAT0005879
Sequence

70 - 

uggaguccaggaaucugcauuuu

 - 92

Get sequence
Deep sequencing204 reads, 59 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).