Stem-loop sequence hsa-mir-1289-1

Accession

MI0006350

Symbol

HGNC:MIR1289-1

Description

Homo sapiens miR-1289-1 stem-loop

Gene family

MIPF0000626; mir-1289

Stem-loop

--         uuuagua       aaaacaaa   --ggu         c      u          ---ag  a 
  uucucaauu       ggaauua        acu     aaaugcaga ucuugg uuccaccccc     ag a
  |||||||||       |||||||        |||     ||||||||| |||||| ||||||||||     || u
  aaggguuaa       ucuuagu        uga     uuuacgucu aggacc gagguggggg     uc c
ac         ----uag       gggaccca   aagau         a      u          ccaaa  c 

Deep sequencing

9 reads, 8 experiments

Genome context

• Coordinates (GRCh37.p5): chr20: 34041776-34041919 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000078875 ; GDF5-001; intron 1

  OTTHUMT00000078875 ; GDF5-001; intron 1

  OTTHUMT00000078875 ; GDF5-001; intron 1

  ENST00000374372 ; GDF5-001; intron 1

  ENST00000374372 ; GDF5-001; intron 1

  ENST00000374372 ; GDF5-001; intron 1

Database links

• ENTREZGENE: 100302125;MIR1289-1
• HGNC: 35281;MIR1289-1

Mature sequence hsa-miR-1289

• Accession: MIMAT0005879
• Sequence: 86 - uggaguccaggaaucugcauuuu - 108
• Deep sequencing: 4 reads, 3 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1289
  • MICRORNA.ORG:hsa-miR-1289
  • MIRDB:hsa-miR-1289
  • RNA22-HSA:hsa-miR-1289
  • TARGETMINER:hsa-miR-1289
  • TARGETSCAN-VERT:hsa-miR-1289

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).