|
miRBase |
|
Stem-loop sequence hsa-mir-1287 |
|||||
| Accession | MI0006349 | ||||
| Symbol | HGNC:MIR1287 | ||||
| Description | Homo sapiens miR-1287 stem-loop | ||||
| Gene family | MIPF0000725; mir-1287 | ||||
| Stem-loop |
-- ug cug gu g a c cu a cuu gu ug uccag gcug auc gugguu gagu g gc u || || ||||| |||| ||| |||||| |||| | || ca ac agguu ugac uag caccga cuca c cg a aa gu -cg ag g a u -- - aaa |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-1287 |
|
| Accession | MIMAT0005878 |
| Sequence |
16 - ugcuggaucagugguucgaguc - 37 |
| Deep sequencing | 698 reads, 18 experiments |
| Evidence | experimental; Solexa [1], 454 [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|
| 2 |
PMID:19508715
"Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing"
BMC Med Genomics. 2:35(2009).
|