Stem-loop sequence hsa-mir-1286

Accession

MI0006348

Symbol

HGNC:MIR1286

Description

Homo sapiens miR-1286 stem-loop

Gene family

MIPF0000682; mir-1286

Stem-loop

--ug   u ug   a    g    c   g  u     au 
    ucc c  ggg cuca cuug ucu gc gcugg  u
    ||| |  ||| |||| |||| ||| || |||||   
    agg g  ucc gagu gaac agg cg cgauu  g
acag   u gu   c    a    c   a  u     aa 

Deep sequencing

307 reads, 9 experiments

Genome context

• Coordinates (GRCh37.p5): chr22: 20236657-20236734 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000318964 ; RTN4R-002; intron 1

  OTTHUMT00000318950 ; RTN4R-001; intron 1

  OTTHUMT00000318968 ; RTN4R-006; intron 1

  OTTHUMT00000318967 ; RTN4R-005; intron 1

  OTTHUMT00000318964 ; RTN4R-002; intron 1

  OTTHUMT00000318950 ; RTN4R-001; intron 1

  OTTHUMT00000318968 ; RTN4R-006; intron 1

  OTTHUMT00000318967 ; RTN4R-005; intron 1

  OTTHUMT00000318964 ; RTN4R-002; intron 1

  OTTHUMT00000318950 ; RTN4R-001; intron 1

  OTTHUMT00000318968 ; RTN4R-006; intron 1

  OTTHUMT00000318967 ; RTN4R-005; intron 1

  OTTHUMT00000318969 ; RTN4R-007; intron 2

  OTTHUMT00000318969 ; RTN4R-007; intron 2

  OTTHUMT00000318969 ; RTN4R-007; intron 2

  ENST00000416372 ; RTN4R-002; intron 1

  ENST00000043402 ; RTN4R-001; intron 1

  ENST00000469601 ; RTN4R-006; intron 1

  ENST00000463936 ; RTN4R-005; intron 1

  ENST00000416372 ; RTN4R-002; intron 1

  ENST00000043402 ; RTN4R-001; intron 1

  ENST00000469601 ; RTN4R-006; intron 1

  ENST00000463936 ; RTN4R-005; intron 1

  ENST00000416372 ; RTN4R-002; intron 1

  ENST00000043402 ; RTN4R-001; intron 1

  ENST00000469601 ; RTN4R-006; intron 1

  ENST00000463936 ; RTN4R-005; intron 1

  ENST00000474642 ; RTN4R-007; intron 2

  ENST00000474642 ; RTN4R-007; intron 2

  ENST00000474642 ; RTN4R-007; intron 2

Database links

• ENTREZGENE: 100302118;MIR1286
• HGNC: 35279;MIR1286

Mature sequence hsa-miR-1286

• Accession: MIMAT0005877
• Sequence: 47 - ugcaggaccaagaugagcccu - 67
• Deep sequencing: 307 reads, 9 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1286
  • MICRORNA.ORG:hsa-miR-1286
  • MIRDB:hsa-miR-1286
  • RNA22-HSA:hsa-miR-1286
  • TARGETMINER:hsa-miR-1286
  • TARGETSCAN-VERT:hsa-miR-1286

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).