Stem-loop sequence hsa-mir-1285-2

AccessionMI0006347 (change log)
Symbol HGNC:MIR1285-2
DescriptionHomo sapiens miR-1285-2 stem-loop
Gene family MIPF0000559; mir-1285
Literature search

25 open access papers mention hsa-mir-1285-2
(69 sentences)

Stem-loop
   --    -      c    cuggugca      --ga      caau   a 
5'   uuug ggaggc gagg        ucacuu    gcccag    uug g
     |||| |||||| ||||        ||||||    ||||||    |||  
3'   aaac ucucug cucc        agugaa    cggguc    aac a
   ag    a      c    ------ag      acaa      ---u   c 
Get sequence
Deep sequencing
9612 reads, 17.7 reads per million, 158 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 70252918-70253005 [-]
sense
OTTHUMT00000462170 ; AC136007.2-048; intron 2
OTTHUMT00000462174 ; AC136007.2-044; intron 2
OTTHUMT00000329422 ; AC136007.2-009; intron 3
OTTHUMT00000329612 ; AC136007.2-021; intron 3
OTTHUMT00000329629 ; AC136007.2-038; intron 3
OTTHUMT00000329614 ; AC136007.2-023; intron 3
OTTHUMT00000329418 ; AC136007.2-005; intron 4
OTTHUMT00000329604 ; AC136007.2-013; intron 4
OTTHUMT00000329613 ; AC136007.2-022; intron 4
OTTHUMT00000462171 ; AC136007.2-052; intron 4
OTTHUMT00000329620 ; AC136007.2-029; intron 4
OTTHUMT00000329420 ; AC136007.2-007; intron 4
OTTHUMT00000329608 ; AC136007.2-017; intron 4
OTTHUMT00000329606 ; AC136007.2-015; intron 4
OTTHUMT00000329421 ; AC136007.2-008; intron 4
OTTHUMT00000329616 ; AC136007.2-025; intron 4
OTTHUMT00000329607 ; AC136007.2-016; intron 4
OTTHUMT00000462173 ; AC136007.2-054; intron 6
OTTHUMT00000329414 ; AC136007.2-001; intron 7
ENST00000594376 ; PCBP1-AS1-048; intron 2
ENST00000601431 ; PCBP1-AS1-044; intron 2
ENST00000457076 ; PCBP1-AS1-009; intron 3
ENST00000418564 ; PCBP1-AS1-021; intron 3
ENST00000415222 ; PCBP1-AS1-038; intron 3
ENST00000418308 ; PCBP1-AS1-023; intron 3
ENST00000413436 ; PCBP1-AS1-005; intron 4
ENST00000456161 ; PCBP1-AS1-013; intron 4
ENST00000419963 ; PCBP1-AS1-022; intron 4
ENST00000599673 ; PCBP1-AS1-052; intron 4
ENST00000452431 ; PCBP1-AS1-029; intron 4
ENST00000423402 ; PCBP1-AS1-007; intron 4
ENST00000411429 ; PCBP1-AS1-017; intron 4
ENST00000420309 ; PCBP1-AS1-015; intron 4
ENST00000434781 ; PCBP1-AS1-008; intron 4
ENST00000415742 ; PCBP1-AS1-025; intron 4
ENST00000457770 ; PCBP1-AS1-016; intron 4
ENST00000596028 ; PCBP1-AS1-054; intron 6
ENST00000435880 ; PCBP1-AS1-001; intron 7
Database links

Mature sequence hsa-miR-1285-3p

Accession MIMAT0005876
Previous IDshsa-miR-1285
Sequence

52 - 

ucugggcaacaaagugagaccu

 - 73

Get sequence
Deep sequencing17819 reads, 154 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).