Stem-loop sequence hsa-mir-1285-1

Accession MI0006346
Symbol HGNC:MIR1285-1
Description Homo sapiens miR-1285-1 stem-loop
Gene family MIPF0000559; mir-1285
Stem-loop 
--            a                    ug ucuc 
  uguagagauagg ucucacuuuguugcccaggc  g    a
  |||||||||||| ||||||||||||||||||||  |     
  acaucucuauuc agagugaaacaacgggucug  c    a
ga            c                    gu cuca
Get sequence
Deep sequencing
1596 reads, 34 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 91833329-91833412 [-]
sense
OTTHUMT00000342025 ; AC000120.7-001; intron 1
OTTHUMT00000342025 ; AC000120.7-001; intron 1
OTTHUMT00000342025 ; AC000120.7-001; intron 1
OTTHUMT00000342034 ; KRIT1-007; intron 10
OTTHUMT00000342034 ; KRIT1-007; intron 10
OTTHUMT00000342034 ; KRIT1-007; intron 10
OTTHUMT00000342033 ; KRIT1-006; intron 11
OTTHUMT00000342033 ; KRIT1-006; intron 11
OTTHUMT00000342033 ; KRIT1-006; intron 11
OTTHUMT00000342030 ; KRIT1-003; intron 15
OTTHUMT00000342030 ; KRIT1-003; intron 15
OTTHUMT00000342030 ; KRIT1-003; intron 15
OTTHUMT00000253910 ; KRIT1-001; intron 17
OTTHUMT00000342032 ; KRIT1-005; intron 17
OTTHUMT00000342031 ; KRIT1-004; intron 17
OTTHUMT00000253910 ; KRIT1-001; intron 17
OTTHUMT00000342032 ; KRIT1-005; intron 17
OTTHUMT00000342031 ; KRIT1-004; intron 17
OTTHUMT00000253910 ; KRIT1-001; intron 17
OTTHUMT00000342032 ; KRIT1-005; intron 17
OTTHUMT00000342031 ; KRIT1-004; intron 17
ENST00000414227 ; AC000120.7-001; intron 1
ENST00000414227 ; AC000120.7-001; intron 1
ENST00000414227 ; AC000120.7-001; intron 1
ENST00000475770 ; KRIT1-007; intron 10
ENST00000475770 ; KRIT1-007; intron 10
ENST00000475770 ; KRIT1-007; intron 10
ENST00000486261 ; KRIT1-006; intron 11
ENST00000486261 ; KRIT1-006; intron 11
ENST00000486261 ; KRIT1-006; intron 11
ENST00000394503 ; KRIT1-003; intron 15
ENST00000394503 ; KRIT1-003; intron 15
ENST00000394503 ; KRIT1-003; intron 15
ENST00000340022 ; KRIT1-001; intron 17
ENST00000412043 ; KRIT1-005; intron 17
ENST00000394505 ; KRIT1-004; intron 17
ENST00000340022 ; KRIT1-001; intron 17
ENST00000412043 ; KRIT1-005; intron 17
ENST00000394505 ; KRIT1-004; intron 17
ENST00000340022 ; KRIT1-001; intron 17
ENST00000412043 ; KRIT1-005; intron 17
ENST00000394505 ; KRIT1-004; intron 17
ENST00000394507 ; KRIT1-201; intron 18
ENST00000415227 ; KRIT1-202; intron 18
ENST00000394507 ; KRIT1-201; intron 18
ENST00000415227 ; KRIT1-202; intron 18
ENST00000394507 ; KRIT1-201; intron 18
Database links

Mature sequence hsa-miR-1285-5p

Accession MIMAT0022719
Sequence

12 -  

gaucucacuuuguugcccagg

 - 32

Get sequence
Deep sequencing 74 reads, 26 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-1285-3p

Accession MIMAT0005876
Previous IDs hsa-miR-1285
Sequence

51 -  

ucugggcaacaaagugagaccu

 - 72

Get sequence
Deep sequencing 2924 reads, 29 experiments
Evidence experimental; Solexa [1]
Validated targets
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).