|
miRBase |
|
Stem-loop sequence hsa-mir-548j |
|||||
| Accession | MI0006345 | ||||
| Symbol | HGNC:MIR548J | ||||
| Description | Homo sapiens miR-548j stem-loop | ||||
| Gene family | MIPF0000317; mir-548 | ||||
| Stem-loop |
-- agc -aa ua u c g ac gggc cagug uagu gcuggugcaaaaguaau gcggu uuug uauu u |||| ||||| |||| ||||||||||||||||| ||||| |||| |||| cuug gucgc auca cgaccacguuuucauua cguca aaac guga u ga --a aag uc - a g cu |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-548j |
|
| Accession | MIMAT0005875 |
| Sequence |
29 - aaaaguaauugcggucuuuggu - 50 |
| Deep sequencing | 158 reads, 13 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|