|
miRBase |
|
Stem-loop sequence hsa-mir-548e |
|||||
| Accession | MI0006344 | ||||
| Symbol | HGNC:MIR548E | ||||
| Description | Homo sapiens miR-548e stem-loop | ||||
| Gene family | MIPF0000317; mir-548 | ||||
| Stem-loop |
-- a caa g a c uuauuagguuggu caaaag uc cgguuuuugcu uua u ||||||||||||| |||||| || ||||||||||| ||| gauaguccaacca guuuuc ag gucaaaaacgg aau u aa c auc a a u |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-548e |
|
| Accession | MIMAT0005874 |
| Sequence |
53 - aaaaacugagacuacuuuugca - 74 |
| Deep sequencing | 311 reads, 21 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|