Stem-loop sequence rno-mir-146b

AccessionMI0006342 (change log)
DescriptionRattus norvegicus miR-146b stem-loop
Gene family MIPF0000103; mir-146
Literature search

50 open access papers mention rno-mir-146b
(201 sentences)

Stem-loop
       -  -  u   -  ug        a    a    ----    gaa 
5' uggc ca cc ggc cc  agaacuga uucc uagg    cugu   c
   |||| || || ||| ||  |||||||| |||| ||||    ||||    
3' aucg gu gg ccg gg  ucuugacu aggg aucc    gacg   u
       u  c  u   u  --        c    -    cgua    auc 
Get sequence
Deep sequencing
573357 reads, 464 reads per million, 503 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 266089488-266089575 [+]
intergenic
Database links

Mature sequence rno-miR-146b-5p

Accession MIMAT0005595
Previous IDsrno-miR-146b
Sequence

15 - 

ugagaacugaauuccauaggcugu

 - 38

Get sequence
Deep sequencing572386 reads, 503 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-146b-3p

Accession MIMAT0017334
Previous IDsrno-miR-146b*
Sequence

55 - 

ccuagggacucaguucuggug

 - 75

Get sequence
Deep sequencing963 reads, 222 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).