Stem-loop sequence rno-mir-146b

Accession MI0006342
Description Rattus norvegicus miR-146b stem-loop
Gene family MIPF0000103; mir-146
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-146. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-146 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-146 is primarily involved in the regulation of inflammation and other process that function in the innate immune system. Loss of functional miR-146 (and mir-145) could predispose an individual to suffer from chromosome 5q deletion syndrome. miR-146 has also been reported to be highly upregulated in osteoarthritis cartilage, and could be involved in its pathogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    -  -  u   -  ug        a    a    ----    gaa 
uggc ca cc ggc cc  agaacuga uucc uagg    cugu   c
|||| || || ||| ||  |||||||| |||| ||||    ||||    
aucg gu gg ccg gg  ucuugacu aggg aucc    gacg   u
    u  c  u   u  --        c    -    cgua    auc 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
1: 251558047-251558134 [+]
intergenic
Database links

Mature sequence rno-miR-146b-5p

Accession MIMAT0005595
Previous IDs rno-miR-146b
Sequence

15 - 

ugagaacugaauuccauaggcugu

 - 38

Get sequence
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-146b-3p

Accession MIMAT0017334
Previous IDs rno-miR-146b*
Sequence

55 - 

ccuagggacucaguucuggug

 - 75

Get sequence
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).