Stem-loop sequence hsa-mir-1208

AccessionMI0006341 (change log)
Symbol HGNC:MIR1208
DescriptionHomo sapiens miR-1208 stem-loop
Gene family MIPF0000628; mir-1208
Stem-loop
   -     g   -aauc   gu     ca    -    cg 
5'  caccg cag     acu  ucaga  ggcg gaga  g
    ||||| |||     |||  |||||  |||| ||||   
3'  guggu guc     uga  agucu  ccgc cuuu  g
   g     -   accac   gu     -c    u    cu 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 128150116-128150188 [+]
intergenic
Database links

Mature sequence hsa-miR-1208

Accession MIMAT0005873
Sequence

12 - 

ucacuguucagacaggcgga

 - 31

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:18314482 "The identification of microRNAs in a genomically unstable region of human chromosome 8q24" Huppi K, Volfovsky N, Runfola T, Jones TL, Mackiewicz M, Martin SE, Mushinski JF, Stephens R, Caplen NJ Mol Cancer Res. 6:212-221(2008).