Stem-loop sequence hsa-mir-1207

AccessionMI0006340 (change log)
Symbol HGNC:MIR1207
DescriptionHomo sapiens miR-1207 stem-loop
Gene family MIPF0000596; mir-1207
Literature search

37 open access papers mention hsa-mir-1207
(67 sentences)

Stem-loop
        ---    -gca      c  gga     ug     -    gg 
5' gcagg   gcug    gggagg ug   ggggc  gcugg gucu  u
   |||||   ||||    |||||| ||   |||||  ||||| ||||   
3' ugucu   cgac    uucuuu ac   ucccg  cgacu cggg  a
        uca    agaa      -  ---     gu     a    ug 
Get sequence
Deep sequencing
50 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 128049152-128049238 [+]
intergenic
Database links

Mature sequence hsa-miR-1207-5p

Accession MIMAT0005871
Sequence

8 - 

uggcagggaggcugggagggg

 - 28

Get sequence
Deep sequencing26 reads, 20 experiments
Evidence experimental; Northern [1]
Predicted targets

Mature sequence hsa-miR-1207-3p

Accession MIMAT0005872
Sequence

52 - 

ucagcuggcccucauuuc

 - 69

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:18314482 "The identification of microRNAs in a genomically unstable region of human chromosome 8q24" Huppi K, Volfovsky N, Runfola T, Jones TL, Mackiewicz M, Martin SE, Mushinski JF, Stephens R, Caplen NJ Mol Cancer Res. 6:212-221(2008).