Stem-loop sequence hsa-mir-1207

Accession

MI0006340

Symbol

HGNC:MIR1207

Description

Homo sapiens miR-1207 stem-loop

Gene family

MIPF0000596; mir-1207

Stem-loop

     ---    -gca      c  gga     ug     -    gg 
gcagg   gcug    gggagg ug   ggggc  gcugg gucu  u
|||||   ||||    |||||| ||   |||||  ||||| ||||   
ugucu   cgac    uucuuu ac   ucccg  cgacu cggg  a
     uca    agaa      -  ---     gu     a    ug 

Deep sequencing

10 reads, 6 experiments

Genome context

• Coordinates (GRCh37.p5): chr8: 129061398-129061484 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000380708 ; PVT1-016; intron 2

  OTTHUMT00000380709 ; PVT1-018; intron 2

  OTTHUMT00000380711 ; PVT1-017; intron 2

  OTTHUMT00000380708 ; PVT1-016; intron 2

  OTTHUMT00000380709 ; PVT1-018; intron 2

  OTTHUMT00000380711 ; PVT1-017; intron 2

  OTTHUMT00000380708 ; PVT1-016; intron 2

  OTTHUMT00000380709 ; PVT1-018; intron 2

  OTTHUMT00000380711 ; PVT1-017; intron 2

  OTTHUMT00000380704 ; PVT1-004; intron 4

  OTTHUMT00000380704 ; PVT1-004; intron 4

  OTTHUMT00000380704 ; PVT1-004; intron 4

  OTTHUMT00000380710 ; PVT1-019; intron 5

  OTTHUMT00000380710 ; PVT1-019; intron 5

  OTTHUMT00000380710 ; PVT1-019; intron 5

  ENST00000512617 ; PVT1-016; intron 2

  ENST00000521600 ; PVT1-018; intron 2

  ENST00000523190 ; PVT1-017; intron 2

  ENST00000512617 ; PVT1-016; intron 2

  ENST00000521600 ; PVT1-018; intron 2

  ENST00000523190 ; PVT1-017; intron 2

  ENST00000512617 ; PVT1-016; intron 2

  ENST00000521600 ; PVT1-018; intron 2

  ENST00000523190 ; PVT1-017; intron 2

  ENST00000513868 ; PVT1-004; intron 4

  ENST00000513868 ; PVT1-004; intron 4

  ENST00000513868 ; PVT1-004; intron 4

  ENST00000522875 ; PVT1-019; intron 5

  ENST00000522875 ; PVT1-019; intron 5

  ENST00000522875 ; PVT1-019; intron 5

Database links

• ENTREZGENE: 100302175;MIR1207
• HGNC: 35273;MIR1207

Mature sequence hsa-miR-1207-5p

• Accession: MIMAT0005871
• Sequence: 8 - uggcagggaggcugggagggg - 28
• Deep sequencing: 3 reads, 2 experiments
• Evidence: experimental; Northern [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1207-5p
  • MICRORNA.ORG:hsa-miR-1207-5p
  • MIRDB:hsa-miR-1207-5p
  • RNA22-HSA:hsa-miR-1207-5p
  • TARGETMINER:hsa-miR-1207-5p
  • TARGETSCAN-VERT:hsa-miR-1207-5p

Mature sequence hsa-miR-1207-3p

• Accession: MIMAT0005872
• Sequence: 52 - ucagcuggcccucauuuc - 69
• Evidence: experimental; Northern [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1207-3p
  • MICRORNA.ORG:hsa-miR-1207-3p
  • MIRDB:hsa-miR-1207-3p
  • RNA22-HSA:hsa-miR-1207-3p
  • TARGETMINER:hsa-miR-1207-3p
  • TARGETSCAN-VERT:hsa-miR-1207-3p

References

1. PMID:18314482 "The identification of microRNAs in a genomically unstable region of human chromosome 8q24" Huppi K, Volfovsky N, Runfola T, Jones TL, Mackiewicz M, Martin SE, Mushinski JF, Stephens R, Caplen NJ Mol Cancer Res. 6:212-221(2008).