Stem-loop sequence hsa-mir-1206

Accession MI0006339
Symbol HGNC:MIR1206
Description Homo sapiens miR-1206 stem-loop
Gene family MIPF0000634; mir-1206
Stem-loop 
          g   -a   uu    u  ug 
caguguucau uag  ugu  aagc cu  c
|||||||||| |||  |||  |||| ||   
gucgcaagug auc  acg  uuug ga  a
          -   ga   uu    -  ug
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr8: 129021144-129021202 [+]
sense
OTTHUMT00000380708 ; PVT1-016; intron 1
OTTHUMT00000380709 ; PVT1-018; intron 1
OTTHUMT00000380708 ; PVT1-016; intron 1
OTTHUMT00000380709 ; PVT1-018; intron 1
OTTHUMT00000380708 ; PVT1-016; intron 1
OTTHUMT00000380709 ; PVT1-018; intron 1
OTTHUMT00000380710 ; PVT1-019; intron 3
OTTHUMT00000380710 ; PVT1-019; intron 3
OTTHUMT00000380710 ; PVT1-019; intron 3
OTTHUMT00000380704 ; PVT1-004; intron 4
OTTHUMT00000380704 ; PVT1-004; intron 4
OTTHUMT00000380704 ; PVT1-004; intron 4
ENST00000512617 ; PVT1-016; intron 1
ENST00000521600 ; PVT1-018; intron 1
ENST00000512617 ; PVT1-016; intron 1
ENST00000521600 ; PVT1-018; intron 1
ENST00000512617 ; PVT1-016; intron 1
ENST00000521600 ; PVT1-018; intron 1
ENST00000522875 ; PVT1-019; intron 3
ENST00000522875 ; PVT1-019; intron 3
ENST00000522875 ; PVT1-019; intron 3
ENST00000513868 ; PVT1-004; intron 4
ENST00000513868 ; PVT1-004; intron 4
ENST00000513868 ; PVT1-004; intron 4
Database links

Mature sequence hsa-miR-1206

Accession MIMAT0005870
Sequence

4 -  

uguucauguagauguuuaagc

 - 24

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:18314482 "The identification of microRNAs in a genomically unstable region of human chromosome 8q24" Huppi K, Volfovsky N, Runfola T, Jones TL, Mackiewicz M, Martin SE, Mushinski JF, Stephens R, Caplen NJ Mol Cancer Res. 6:212-221(2008).