Stem-loop sequence hsa-mir-1205

Accession

MI0006338

Symbol

HGNC:MIR1205

Description

Homo sapiens miR-1205 stem-loop

Gene family

MIPF0000609; mir-1205

Stem-loop

ga    cu --u        u  uuu    u 
  aggc  c   gcaggguu gc   gagg a
  ||||  |   |||||||| ||   |||| c
  ucug  g   ugucccaa ug   uucc u
ug    ag ucu        c  ucc    u 

Deep sequencing

1 reads, 1 experiments

Genome context

• Coordinates (GRCh37.p5): chr8: 128972879-128972941 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000380706 ; PVT1-014; intron 1

  OTTHUMT00000380706 ; PVT1-014; intron 1

  OTTHUMT00000380706 ; PVT1-014; intron 1

  OTTHUMT00000380704 ; PVT1-004; intron 2

  OTTHUMT00000380707 ; PVT1-015; intron 2

  OTTHUMT00000380704 ; PVT1-004; intron 2

  OTTHUMT00000380707 ; PVT1-015; intron 2

  OTTHUMT00000380704 ; PVT1-004; intron 2

  OTTHUMT00000380707 ; PVT1-015; intron 2

  ENST00000519481 ; PVT1-014; intron 1

  ENST00000519481 ; PVT1-014; intron 1

  ENST00000519481 ; PVT1-014; intron 1

  ENST00000513868 ; PVT1-004; intron 2

  ENST00000517838 ; PVT1-015; intron 2

  ENST00000513868 ; PVT1-004; intron 2

  ENST00000517838 ; PVT1-015; intron 2

  ENST00000513868 ; PVT1-004; intron 2

  ENST00000517838 ; PVT1-015; intron 2

Database links

• ENTREZGENE: 100302161;MIR1205
• HGNC: 35271;MIR1205

Mature sequence hsa-miR-1205

• Accession: MIMAT0005869
• Sequence: 8 - ucugcaggguuugcuuugag - 27
• Evidence: experimental; Northern [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1205
  • MICRORNA.ORG:hsa-miR-1205
  • MIRDB:hsa-miR-1205
  • RNA22-HSA:hsa-miR-1205
  • TARGETMINER:hsa-miR-1205
  • TARGETSCAN-VERT:hsa-miR-1205

References

1. PMID:18314482 "The identification of microRNAs in a genomically unstable region of human chromosome 8q24" Huppi K, Volfovsky N, Runfola T, Jones TL, Mackiewicz M, Martin SE, Mushinski JF, Stephens R, Caplen NJ Mol Cancer Res. 6:212-221(2008).