Stem-loop sequence hsa-mir-1204

Accession MI0006337
Symbol HGNC:MIR1204
Description Homo sapiens miR-1204 stem-loop
Gene family MIPF0000671; mir-1204
Stem-loop
   u  u   cug   uc    a  ug     a 
acc cg ggc   guc  cauu uu  agaug g
||| || |||   |||  |||| ||  ||||| u
ugg gc ccg   cag  gugg ag  ucuac u
   u  u   -ug   ga    -  gu     a 
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr8: 128808208-128808274 [+]
sense
OTTHUMT00000380693 ; PVT1-005; intron 1
OTTHUMT00000380695 ; PVT1-003; intron 1
OTTHUMT00000380696 ; PVT1-002; intron 1
OTTHUMT00000380698 ; PVT1-011; intron 1
OTTHUMT00000380699 ; PVT1-007; exon 1
OTTHUMT00000380700 ; PVT1-008; exon 1
OTTHUMT00000380701 ; PVT1-009; exon 1
OTTHUMT00000380693 ; PVT1-005; intron 1
OTTHUMT00000380695 ; PVT1-003; intron 1
OTTHUMT00000380696 ; PVT1-002; intron 1
OTTHUMT00000380698 ; PVT1-011; intron 1
OTTHUMT00000380699 ; PVT1-007; exon 1
OTTHUMT00000380700 ; PVT1-008; exon 1
OTTHUMT00000380701 ; PVT1-009; exon 1
OTTHUMT00000380693 ; PVT1-005; intron 1
OTTHUMT00000380695 ; PVT1-003; intron 1
OTTHUMT00000380696 ; PVT1-002; intron 1
OTTHUMT00000380698 ; PVT1-011; intron 1
OTTHUMT00000380699 ; PVT1-007; exon 1
OTTHUMT00000380700 ; PVT1-008; exon 1
OTTHUMT00000380701 ; PVT1-009; exon 1
OTTHUMT00000380694 ; PVT1-001; exon 2
OTTHUMT00000380697 ; PVT1-006; exon 2
OTTHUMT00000380694 ; PVT1-001; exon 2
OTTHUMT00000380697 ; PVT1-006; exon 2
OTTHUMT00000380694 ; PVT1-001; exon 2
OTTHUMT00000380697 ; PVT1-006; exon 2
ENST00000504719 ; PVT1-005; intron 1
ENST00000523328 ; PVT1-003; intron 1
ENST00000521951 ; PVT1-002; intron 1
ENST00000523427 ; PVT1-011; intron 1
ENST00000517790 ; PVT1-007; exon 1
ENST00000522963 ; PVT1-008; exon 1
ENST00000518528 ; PVT1-009; exon 1
ENST00000504719 ; PVT1-005; intron 1
ENST00000523328 ; PVT1-003; intron 1
ENST00000521951 ; PVT1-002; intron 1
ENST00000523427 ; PVT1-011; intron 1
ENST00000517790 ; PVT1-007; exon 1
ENST00000522963 ; PVT1-008; exon 1
ENST00000518528 ; PVT1-009; exon 1
ENST00000504719 ; PVT1-005; intron 1
ENST00000523328 ; PVT1-003; intron 1
ENST00000521951 ; PVT1-002; intron 1
ENST00000523427 ; PVT1-011; intron 1
ENST00000517790 ; PVT1-007; exon 1
ENST00000522963 ; PVT1-008; exon 1
ENST00000518528 ; PVT1-009; exon 1
ENST00000524165 ; PVT1-001; exon 2
ENST00000517525 ; PVT1-006; exon 2
ENST00000524165 ; PVT1-001; exon 2
ENST00000517525 ; PVT1-006; exon 2
ENST00000524165 ; PVT1-001; exon 2
ENST00000517525 ; PVT1-006; exon 2
Database links

Mature sequence hsa-miR-1204

Accession MIMAT0005868
Sequence

4 - 

ucguggccuggucuccauuau

 - 24

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1
PMID:18314482 "The identification of microRNAs in a genomically unstable region of human chromosome 8q24" Huppi K, Volfovsky N, Runfola T, Jones TL, Mackiewicz M, Martin SE, Mushinski JF, Stephens R, Caplen NJ Mol Cancer Res. 6:212-221(2008).