Stem-loop sequence hsa-mir-663b

AccessionMI0006336 (change log)
Symbol HGNC:MIR663B
DescriptionHomo sapiens miR-663b stem-loop
Gene family MIPF0000462; mir-663
Literature search

66 open access papers mention hsa-mir-663b
(263 sentences)

Stem-loop
   ggu   ga    -  u    - auc     cg  --uc  ug   uacc    u  u  c 
5'    gcc  gggc cg ccgg c   cuagg  gg    gc  cgg    uccc cc gu u
      |||  |||| || |||| |   |||||  ||    ||  |||    |||| || || g
3'    ugg  uccg gc ggcc g   ggucc  uu    cg  gcc    aggg gg cg u
   cuu   ag    u  c    c -gu     uu  gugc  gu   --cu    u  -  g 
Get sequence
Deep sequencing
1745 reads, 9.3 reads per million, 129 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 132256966-132257080 [-]
antisense
OTTHUMT00000331825 ; AC093838.4-003; intron 3
OTTHUMT00000331819 ; AC093838.4-001; intron 3
ENST00000538598 ; AC093838.4-204; intron 1
ENST00000416745 ; AC093838.4-201; intron 2
ENST00000543513 ; AC093838.4-203; intron 2
ENST00000415574 ; AC093838.4-003; intron 3
ENST00000438378 ; AC093838.4-001; intron 3
ENST00000426369 ; AC093838.4-202; intron 3
Database links

Mature sequence hsa-miR-663b

Accession MIMAT0005867
Sequence

90 - 

gguggcccggccgugccugagg

 - 111

Get sequence
Deep sequencing512 reads, 93 experiments
Evidence experimental; miRAP [1]
Database links
Predicted targets

References

1
PMID:17989710 "MicroRNA expression profiles of human leukemias" Takada S, Yamashita Y, Berezikov E, Hatanaka H, Fujiwara SI, Kurashina K, Watanabe H, Enomoto M, Soda M, Choi YL, Mano H Leukemia. 22:1274-1278(2008).