Stem-loop sequence hsa-mir-1200

Accession MI0006332
Symbol HGNC:MIR1200
Description Homo sapiens miR-1200 stem-loop
Gene family MIPF0001036; mir-1200
Stem-loop
u    cu  u     -gcca         uc    a   g 
 gcua  uc ccuga     uucugagcc  aauc cuu c
 ||||  || |||||     |||||||||  |||| |||  
 cgau  ag ggacu     aggacuugg  uuag gag c
c    --  -     guuua         --    a   a 
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 36958962-36959037 [-]
sense
OTTHUMT00000219863 ; ELMO1-002; intron 1
OTTHUMT00000337935 ; ELMO1-019; intron 1
OTTHUMT00000337934 ; ELMO1-018; intron 1
OTTHUMT00000337932 ; ELMO1-016; intron 1
OTTHUMT00000219863 ; ELMO1-002; intron 1
OTTHUMT00000337935 ; ELMO1-019; intron 1
OTTHUMT00000337934 ; ELMO1-018; intron 1
OTTHUMT00000337932 ; ELMO1-016; intron 1
OTTHUMT00000219863 ; ELMO1-002; intron 1
OTTHUMT00000337935 ; ELMO1-019; intron 1
OTTHUMT00000337934 ; ELMO1-018; intron 1
OTTHUMT00000337932 ; ELMO1-016; intron 1
OTTHUMT00000337937 ; ELMO1-021; intron 4
OTTHUMT00000337937 ; ELMO1-021; intron 4
OTTHUMT00000337937 ; ELMO1-021; intron 4
OTTHUMT00000337931 ; ELMO1-015; intron 7
OTTHUMT00000337931 ; ELMO1-015; intron 7
OTTHUMT00000337931 ; ELMO1-015; intron 7
OTTHUMT00000219830 ; ELMO1-001; intron 16
OTTHUMT00000337924 ; ELMO1-008; intron 16
OTTHUMT00000337919 ; ELMO1-003; intron 16
OTTHUMT00000219830 ; ELMO1-001; intron 16
OTTHUMT00000337924 ; ELMO1-008; intron 16
OTTHUMT00000337919 ; ELMO1-003; intron 16
OTTHUMT00000219830 ; ELMO1-001; intron 16
OTTHUMT00000337924 ; ELMO1-008; intron 16
OTTHUMT00000337919 ; ELMO1-003; intron 16
ENST00000396045 ; ELMO1-002; intron 1
ENST00000396040 ; ELMO1-019; intron 1
ENST00000487843 ; ELMO1-018; intron 1
ENST00000464262 ; ELMO1-016; intron 1
ENST00000396045 ; ELMO1-002; intron 1
ENST00000396040 ; ELMO1-019; intron 1
ENST00000487843 ; ELMO1-018; intron 1
ENST00000464262 ; ELMO1-016; intron 1
ENST00000396045 ; ELMO1-002; intron 1
ENST00000396040 ; ELMO1-019; intron 1
ENST00000487843 ; ELMO1-018; intron 1
ENST00000464262 ; ELMO1-016; intron 1
ENST00000472359 ; ELMO1-021; intron 4
ENST00000341056 ; ELMO1-201; intron 4
ENST00000472359 ; ELMO1-021; intron 4
ENST00000341056 ; ELMO1-201; intron 4
ENST00000472359 ; ELMO1-021; intron 4
ENST00000341056 ; ELMO1-201; intron 4
ENST00000420636 ; ELMO1-015; intron 7
ENST00000420636 ; ELMO1-015; intron 7
ENST00000420636 ; ELMO1-015; intron 7
ENST00000361912 ; ELMO1-202; intron 13
ENST00000361912 ; ELMO1-202; intron 13
ENST00000310758 ; ELMO1-001; intron 16
ENST00000442504 ; ELMO1-008; intron 16
ENST00000448602 ; ELMO1-003; intron 16
ENST00000310758 ; ELMO1-001; intron 16
ENST00000442504 ; ELMO1-008; intron 16
ENST00000448602 ; ELMO1-003; intron 16
ENST00000310758 ; ELMO1-001; intron 16
ENST00000442504 ; ELMO1-008; intron 16
ENST00000448602 ; ELMO1-003; intron 16
Database links

Mature sequence hsa-miR-1200

Accession MIMAT0005863
Sequence

9 - 

cuccugagccauucugagccuc

 - 30

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).