Stem-loop sequence mml-mir-1241

Accession MI0006331
Description Macaca mulatta miR-1241 stem-loop
Stem-loop
gugaggg  cu       c    aggcgccagagaagccauag 
       gg  ggcaugg gagg                    u
       ||  ||||||| ||||                    g
       cc  ccguguc cucc                    u
-----ga  uu       u    acucacacgucggguagggg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
20: 66210939-66211022 [+]
sense
ENSMMUT00000016663 ; EDC4-201; intron 6
Database links

Mature sequence mml-miR-1241

Accession MIMAT0005862
Sequence

63 - 

cucaccucucugugccuuccag

 - 84

Get sequence
Evidence experimental; cloned [17964270]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).