Stem-loop sequence mml-mir-1241

AccessionMI0006331
DescriptionMacaca mulatta miR-1241 stem-loop
Stem-loop
gugaggg  cu       c    aggcgccagagaagccauag 
       gg  ggcaugg gagg                    u
       ||  ||||||| ||||                    g
       cc  ccguguc cucc                    u
-----ga  uu       u    acucacacgucggguagggg 
Get sequence
Deep sequencing
1 reads, 0.122 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr20: 66192507-66192590 [+]
intergenic
Database links

Mature sequence mml-miR-1241

Accession MIMAT0005862
Sequence

63 - 

cucaccucucugugccuuccag

 - 84

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).