Stem-loop sequence mml-mir-1241

AccessionMI0006331 (change log)
DescriptionMacaca mulatta miR-1241 stem-loop
Stem-loop
   gugaggg  cu       c    aggcgccagagaagccauag 
5'        gg  ggcaugg gagg                    u
          ||  ||||||| ||||                    g
3'        cc  ccguguc cucc                    u
   -----ga  uu       u    acucacacgucggguagggg 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr20: 52236573-52236656 [+]
intergenic
Database links

Mature sequence mml-miR-1241

Accession MIMAT0005862
Sequence

63 - 

cucaccucucugugccuuccag

 - 84

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).