Stem-loop sequence mml-mir-1240

Accession MI0006330
Description Macaca mulatta miR-1240 stem-loop
Stem-loop
   ---     -c     c  c  gg    -gc    --ca     c 
5'    guggg  caggg cg gg  ggga   aagc    ucuag a
      |||||  ||||| || ||  ||||   ||||    ||||| u
3'    caccc  guccc gu cc  cucu   uucg    ggguc u
   gau     ua     a  a  -a    aca    caaa     c 
Get sequence
Deep sequencing
6 reads, 0.249 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr12: 82966572-82966654 [-]
sense
ENSMMUT00000001133 ; NHEJ1-201; intron 3
Database links

Mature sequence mml-miR-1240

Accession MIMAT0005861
Sequence

60 - 

ucaccaugacccugaucccacu

 - 81

Get sequence
Deep sequencing 2 reads, 1 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).