Stem-loop sequence mml-mir-1240

Accession MI0006330
Description Macaca mulatta miR-1240 stem-loop
Stem-loop
---     -c     c  c  gg    -gc    --ca     c 
   guggg  caggg cg gg  ggga   aagc    ucuag a
   |||||  ||||| || ||  ||||   ||||    ||||| u
   caccc  guccc gu cc  cucu   uucg    ggguc u
gau     ua     a  a  -a    aca    caaa     c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
12: 83077563-83077645 [-]
sense
ENSMMUT00000027555 ; ATG9A-202; intron 7
ENSMMUT00000044562 ; ATG9A-203; intron 7
ENSMMUT00000027554 ; ATG9A-201; intron 8
Database links

Mature sequence mml-miR-1240

Accession MIMAT0005861
Sequence

60 - 

ucaccaugacccugaucccacu

 - 81

Get sequence
Evidence experimental; cloned [17964270]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).