Stem-loop sequence mml-mir-1240

AccessionMI0006330 (change log)
DescriptionMacaca mulatta miR-1240 stem-loop
Stem-loop
   ---     -c     c  c  gg    -gc    --ca     c 
5'    guggg  caggg cg gg  ggga   aagc    ucuag a
      |||||  ||||| || ||  ||||   ||||    ||||| u
3'    caccc  guccc gu cc  cucu   uucg    ggguc u
   gau     ua     a  a  -a    aca    caaa     c 
Get sequence
Deep sequencing
121 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr12: 101351871-101351953 [-]
sense
ENSMMUT00000001133 ; NHEJ1-201; intron 3
Database links

Mature sequence mml-miR-1240

Accession MIMAT0005861
Sequence

60 - 

ucaccaugacccugaucccacu

 - 81

Get sequence
Deep sequencing118 reads, 6 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).