Stem-loop sequence mml-mir-1239

AccessionMI0006329
DescriptionMacaca mulatta miR-1239 stem-loop
Stem-loop
g     -       ugg u       cc      g u      ucucu       c 
 ugggu gggcagg   g gggaagc  ugggac c gccucc     ccugggg c
 ||||| |||||||   | |||||||  |||||| | ||||||     |||||||  
 auccg uccgucu   c cccuuug  acucug g cggggg     gggcucu u
g     g       -ua -       --      - u      ---uc       c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 18142344-18142448 [+]
intergenic
Database links

Mature sequence mml-miR-1239

Accession MIMAT0005594
Sequence

84 - 

uuccccauucugccuggccuag

 - 105

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).