Stem-loop sequence hsa-mir-1238

AccessionMI0006328
Symbol HGNC:MIR1238
DescriptionHomo sapiens miR-1238 stem-loop
Gene family MIPF0000941; mir-1238
Stem-loop
   gugag    a  -cc   -  ugu  uug    -  -u   -    g 
5'      uggg gc   cag ug   gg   gggc ca  ggc gggu g
        |||| ||   ||| ||   ||   |||| ||  ||| |||| g
3'      accc cg   guc gc   cc   uccg gu  ccg cccg c
   ----g    -  ucu   u  --u  --u    a  cu   a    a 
Get sequence
Deep sequencing
11 reads, 79.4 reads per million, 13 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 10552122-10552204 [+]
sense
OTTHUMT00000451244 ; PDE4A-001; intron 1
OTTHUMT00000451245 ; PDE4A-002; intron 1
OTTHUMT00000451246 ; PDE4A-003; intron 1
OTTHUMT00000451243 ; PDE4A-005; intron 3
ENST00000352831 ; PDE4A-001; intron 1
ENST00000293683 ; PDE4A-002; intron 1
ENST00000440014 ; PDE4A-003; intron 1
ENST00000380702 ; PDE4A-201; intron 2
ENST00000592685 ; PDE4A-005; intron 3
Database links

Mature sequence hsa-miR-1238-5p

Accession MIMAT0022947
Sequence

1 - 

gugagugggagccccagugugug

 - 23

Get sequence
Evidence not experimental

Mature sequence hsa-miR-1238-3p

Accession MIMAT0005593
Previous IDshsa-miR-1238
Sequence

62 - 

cuuccucgucugucugcccc

 - 81

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).