Stem-loop sequence hsa-mir-1237

AccessionMI0006327
Symbol HGNC:MIR1237
DescriptionHomo sapiens miR-1237 stem-loop
Gene family MIPF0000585; mir-1237
Stem-loop
   gugggagggcccaggcgcgggcagggguggggguggcagagcgcuguccc           c    ----c      
5'                                                   gggggcggggc gaag     gcggc 
                                                     ||||||||||| ||||     |||| g
3'                                                   ccccugccucg cuuc     ugcca 
   -----------------------------------------------gac           u    cucaa      
Get sequence
Deep sequencing
42 reads, 485 reads per million, 30 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr11: 64368602-64368703 [+]
sense
OTTHUMT00000141957 ; SLC22A12-002; intron 8
OTTHUMT00000104966 ; SLC22A12-001; intron 9
OTTHUMT00000141959 ; SLC22A12-004; intron 9
OTTHUMT00000401155 ; SLC22A12-005; intron 9
ENST00000377572 ; SLC22A12-201; intron 7
ENST00000377567 ; SLC22A12-002; intron 8
ENST00000377574 ; SLC22A12-001; intron 9
ENST00000473690 ; SLC22A12-004; intron 9
ENST00000336464 ; SLC22A12-005; intron 9
Database links

Mature sequence hsa-miR-1237-5p

Accession MIMAT0022946
Sequence

50 - 

cgggggcggggccgaagcgcg

 - 70

Get sequence
Evidence not experimental

Mature sequence hsa-miR-1237-3p

Accession MIMAT0005592
Previous IDshsa-miR-1237
Sequence

82 - 

uccuucugcuccgucccccag

 - 102

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).