Stem-loop sequence hsa-mir-1236

AccessionMI0006326
Symbol HGNC:MIR1236
DescriptionHomo sapiens miR-1236 stem-loop
Gene family MIPF0000689; mir-1236
Stem-loop
   -- u   u    -      au    auggacuggaagugggcagcauggagcu 
5'   g gag gaca ggggaa  gggg                            g
     | ||| |||| ||||||  ||||                             
3'   c cuc cugu ccccuu  cucc                            a
   ga -   u    u      --    guaauacaaccgguucgguacuacuucc 
Get sequence
Deep sequencing
20 reads, 49.7 reads per million, 18 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr6: 31956839-31956940 [-]
antisense
OTTHUMT00000076364 ; C4A-001; intron 9
OTTHUMT00000356896 ; C4A-013; intron 9
ENST00000428956 ; C4A-001; intron 9
ENST00000498271 ; C4A-013; intron 9
Database links

Mature sequence hsa-miR-1236-5p

Accession MIMAT0022945
Sequence

2 - 

ugagugacaggggaaaugggga

 - 23

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence not experimental

Mature sequence hsa-miR-1236-3p

Accession MIMAT0005591
Previous IDshsa-miR-1236
Sequence

81 - 

ccucuuccccuugucucuccag

 - 102

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).