Stem-loop sequence mml-mir-1235

Accession MI0006325
Description Macaca mulatta miR-1235 stem-loop
Stem-loop
   g    ccug  u     g  ac        u  g   g 
5'  uggg    gg cggug gg  ggggcggc gg cgu c
    ||||    || ||||| ||  |||||||| || ||| c
3'  accc    cc gccac cc  ucucgucg cc gcg c
   g    ----  u     g  aa        -  g   u 
Get sequence
Deep sequencing
1 reads, 0.0964 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-1235

Accession MIMAT0005590
Sequence

54 - 

ucuaaccgcaccgucccccag

 - 74

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).