Stem-loop sequence hsa-mir-1234

AccessionMI0006324 (change log)
Symbol HGNC:MIR1234
DescriptionHomo sapiens miR-1234 stem-loop
Literature search

5 open access papers mention hsa-mir-1234
(20 sentences)

Stem-loop
   gugag          c   ---   ----g   g         g 
5'      uguggggugg ugg   ggc     ggg gggcccggg a
        |||||||||| |||   |||     ||| ||||||||| c
3'      acaccccacc acc   ccg     ucc uccggguuc g
   ----g          c   agu   gcuga   g         g 
Get sequence
Deep sequencing
9748 reads, 1.24e+03 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 144400086-144400165 [-]
sense
OTTHUMT00000381247 ; TOP1MT-001; intron 9
OTTHUMT00000381248 ; TOP1MT-002; intron 9
OTTHUMT00000381298 ; TOP1MT-007; intron 9
OTTHUMT00000381299 ; TOP1MT-006; intron 9
OTTHUMT00000381294 ; TOP1MT-003; intron 10
OTTHUMT00000381295 ; TOP1MT-005; intron 10
ENST00000329245 ; TOP1MT-001; intron 9
ENST00000519148 ; TOP1MT-002; intron 9
ENST00000518951 ; TOP1MT-007; intron 9
ENST00000519139 ; TOP1MT-006; intron 9
ENST00000521193 ; TOP1MT-003; intron 10
ENST00000523676 ; TOP1MT-005; intron 10
Clustered miRNAs
< 10kb from hsa-mir-1234
hsa-mir-6849chr8: 144400277-144400345 [-]
hsa-mir-1234chr8: 144400086-144400165 [-]
hsa-mir-939chr8: 144394149-144394230 [-]
Database links

Mature sequence hsa-miR-1234-3p

Accession MIMAT0005589
Previous IDshsa-miR-1234
Sequence

57 - 

ucggccugaccacccaccccac

 - 78

Get sequence
Deep sequencing16 reads, 10 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).