Stem-loop sequence hsa-mir-1233-1

AccessionMI0006323 (change log)
Previous IDshsa-mir-1233
Symbol HGNC:MIR1233-1
DescriptionHomo sapiens miR-1233-1 stem-loop
Gene family MIPF0000578; mir-1233
Stem-loop
   guga        c      acgg    ggga    ca     aug 
5'     gugggagg cagggc    cagg    gcug  gggcu   g
       |||||||| ||||||    ||||    ||||  |||||    
3'     cgcccucc gucccg    gucu    cgac  cccgg   g
   --ga        u      ---a    ---g    --     gga 
Get sequence
Deep sequencing
47 reads, 4 reads per million, 25 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 34382069-34382150 [-]
sense
OTTHUMT00000387961 ; EMC7-003; intron 2
OTTHUMT00000251519 ; EMC7-001; intron 3
OTTHUMT00000387962 ; EMC7-004; intron 3
ENST00000527822 ; EMC7-003; intron 2
ENST00000256545 ; EMC7-001; intron 3
ENST00000528949 ; EMC7-004; intron 3
Database links

Mature sequence hsa-miR-1233-5p

Accession MIMAT0022943
Sequence

4 - 

agugggaggccagggcacggca

 - 25

Get sequence
Deep sequencing32 reads, 13 experiments
Evidence experimental; meta-analysis [2]
Predicted targets

Mature sequence hsa-miR-1233-3p

Accession MIMAT0005588
Previous IDshsa-miR-1233
Sequence

63 - 

ugagcccuguccucccgcag

 - 82

Get sequence
Deep sequencing32 reads, 10 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).